Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA018950 Similarity: 0.972 Similarity: 0.972 Similarity: 0.969
UTR: 5HSAA018950
Gene: CCNE2
MFE: -53.248
ENS: 0.969
Length: 129.
Predicted Ligands:
FMN - 8/20
cobalamin - 5/20
TPP - 4/20
 RS: URS0000AB3190_555088
MFE: -36.241
Ligand: FMN
Species: Dethiobacter alkaliphilus AHT 1 FMN riboswitch (RFN element)
 RS: URS000231CF1F_862751
MFE: -61.193
Ligand: cobalamin
Species: Streptomyces sp. SirexAA-E Cobalamin riboswitch
 RS: URS0000C3F71B_1229783
MFE: -25.032
Ligand: FMN
Species: Staphylococcus massiliensis S46 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA018950 URS0000AB3190_555088 URS000231CF1F_862751 URS0000C3F71B_1229783
Length 129. 129. 128. 130.
Similarity - 0.972 0.972 0.969
Ensemble Norm 0.969 - - -
MFE -53.248 -36.241 -61.193 -25.032
Ligands - FMN cobalamin FMN
Gene CCNE2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.007 6.001 11.001
Length SE - 0. 1. 1.
Lev Distance - 34. 34. 36.
UBS 10. 9. 11. 10.
BS 0. 1. 0. 1.
ILL 2. 2. 2. 4.
ILR 4. 3. 4. 5.
H 2. 2. 2. 2.
BL 2. 4. 4. 1.
BR 4. 4. 5. 2.
UN 0.039 0.124 0.062 0.069

Sequences

Field Description
UTR seq + 25 gugcggggcgggaccggcccggccuauauauuggguuggcgccggcgccagcugagccgagcgguagcuggucuggcgagguuuuauacaccugaaagaagagaATGTCAAGACGAAGTAGCCGTTTAC
UTR dot + 25 ..((..(((((..(((((((((((((…..)))))))).)))))..)).)))..)).(((((((.(((.((((((((((((…….))))…………))))).)))..))).)))))))..
RS 1 seq AUAUUCCUUCAGGGUCAGGUGAGAAGGCAAAGUCCUUCAAUUCCGAACCGGCGGUAUAGCCCGCGAGCACUAAGCUGAUCCGGUGAAAUUCCGGAGCCGACAGUAUAGUCUGGAUGGGAGAAGGAGUUA
RS 1 dot ..((((((((..(((..((…(((((……)))))….))..)))……….(((((.((.((((.((((.(((((…….)))))…..)))).)))))).).)))).))))))))..
RS 2 seq CCGGCUUGUUACGCUUCCCGUGCCUCCCGCGGGGGAAGCCGGUGAGAGUCCGGCGCUGUCCCGCAACGGUGUGCGUGGCCCGUGCCGGCCACGCGAGUCCGAUCACCCGCGGCAGGUAGGCAACCCGU
RS 2 dot ((((.((.(((((((((((.(((…..))).)))))))..)))).)).)))).(((..((.((..((((((((((((((……)))))))))……..)))).)..)).))..)))…….
RS 3 seq GAAUUCUUUCGGGGCAAGGUGAAAUUCCUAACCGGCAGUAAGUUAAGCCUGCGACCUGCAUAAUCUUUAUGUGGCUGAUCUAGUGAGAAUCUAGAGCCGACAGUUAAAGUCUGGAUGGGAGAAAGAAUGA
RS 3 dot ..((((((((…((.((((..((((((…..))…..))))..))))))..((((..((..(((((((((((…(((((…….)))))))).)))..)))))..))..)))).))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table