Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA019014 Similarity: 0.959 Similarity: 0.957 Similarity: 0.957
UTR: 5HSAA019014
Gene: CCNK
MFE: -36.925
ENS: 0.969
Length: 155.
Predicted Ligands:
FMN - 17/20
cobalamin - 2/20
Mg2+ - 1/20
 RS: URS0000AB351E_365046
MFE: -67.
Ligand: FMN
Species: Ramlibacter tataouinensis TTB310 FMN riboswitch (RFN element)
 RS: URS0000ABB175_596318
MFE: -34.395
Ligand: FMN
Species: Acinetobacter radioresistens SK82 FMN riboswitch (RFN element)
 RS: URS0000C76AA2_1349767
MFE: -48.803
Ligand: FMN
Species: Janthinobacterium agaricidamnosum NBRC 102515 = DSM 9628 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA019014 URS0000AB351E_365046 URS0000ABB175_596318 URS0000C76AA2_1349767
Length 155. 155. 154. 155.
Similarity - 0.959 0.957 0.957
Ensemble Norm 0.969 - - -
MFE -36.925 -67. -34.395 -48.803
Ligands - FMN FMN FMN
Gene CCNK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.007 7.007 8.028
Length SE - 0. 1. 0.
Lev Distance - 54. 54. 55.
UBS 10. 11. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 1. 2. 2. 2.
H 6. 6. 6. 5.
BL 3. 3. 3. 3.
BR 1. 2. 3. 3.
UN 0.065 0.148 0.149 0.232

Sequences

Field Description
UTR seq + 25 gguccccgacauuccauauacaagauggccgcagucggcaaggagagacgucgcugaggggcuugccugaagcgaggggauucuaacauuuucagagaaccuuuuggaaagaacaagccuacuucaauaaATGAAGGAGAATAAAGAAAATTCAA
UTR dot + 25 .(((…)))…((((…….))))((.(((.((((……….))))))).))((((((…….(((((((.((((………..)))))))))))…….))))))..(((((…..)))))..((((…….))))..
RS 1 seq CGAGGUCUUCAGGGCGGGGUGGAAUUCCCCACCGGCGGUAGGCGGCGAAAGCCGCGAGCCCGCGAGCGCCCCGCGGUCCGCCCGGGCCACGGGGGUCAGCAGACUCAGUCAAAUGCUGAGGCCGACGGUCACAGUCCGGAUGAAAGAAGAUUCGC
RS 1 dot …………((.((((…….)))).))…(((..(((((….)))))..))).((..((.(((((.(((((….))))).)))))))..))…((((((…..))))))…(((…….)))(((((……..))))).
RS 2 seq CAUCGCUUCAGGGCGGGGUGAAAUUCCCCACCGGUGGUAAAGUUGUUUCAAUAUAAAAUCAGCAAGCCCACGAGCGUAUUACCUAUUUAAAGUACUACGCAGAUUUGGUGCAAUUCCAAAGCCGACGGUAUAGUCCGGAUGAAAGAAGACGAGA
RS 2 dot ………..((.((((…….)))).)).((((….((((.((……..)).))))….))))..(((((.(((………))).)))))…(((((…….)))))…(((……)))((..(……)..))…
RS 3 seq AUACGUCUUCGGGGCGGGGUGCGAUUCCCCACCGGCGGUAAAACCGGCAACGGUUGAGCCCGCGAGCGCUUGCGGUGCGAUAUUAAUACGGCAAGGUCAGCAGAUCUGGUGCGAAACCAGGGCCGACGGUAUAGUCCGGAUGAAAGAAGAUGUGC
RS 3 dot …………((.((((…….)))).))…(((..(((((….)))))..))).((..((.(((((.(((………))).)))))))..))…((((((…..)))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table