Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA019090 Similarity: 0.953 Similarity: 0.952 Similarity: 0.952
UTR: 5HSAA019090
Gene: CCNO
MFE: -79.427
ENS: 0.805
Length: 182.
Predicted Ligands:
cobalamin - 17/20
lysine - 2/20
FMN - 1/20
 RS: URS000233137D_1367847
MFE: -62.942
Ligand: cobalamin
Species: Paracoccus aminophilus JCM 7686 Cobalamin riboswitch
 RS: URS0002317A97_1122184
MFE: -49.985
Ligand: cobalamin
Species: Lutispora thermophila DSM 19022 Cobalamin riboswitch
 RS: URS0002314F10_1907666
MFE: -74.234
Ligand: cobalamin
Species: Agrobacterium sp. DSM 25559 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA019090 URS000233137D_1367847 URS0002317A97_1122184 URS0002314F10_1907666
Length 182. 183. 183. 181.
Similarity - 0.953 0.952 0.952
Ensemble Norm 0.805 - - -
MFE -79.427 -62.942 -49.985 -74.234
Ligands - cobalamin cobalamin cobalamin
Gene CCNO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 21. 10.001 3.002
Length SE - 1. 1. 1.
Lev Distance - 52. 58. 62.
UBS 11. 15. 11. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 3.
ILR 3. 3. 2. 2.
H 4. 4. 4. 5.
BL 2. 4. 4. 2.
BR 3. 4. 1. 3.
UN 0.077 0.071 0.109 0.122

Sequences

Field Description
UTR seq + 25 agugagaggccgggggugugguagagagaaggagccggccggguacuuaggaccgcgccagccucugagcccggccuccuucgcacuuucgagugcgcguuugcugcccgccgcagcccgggcguugaagguaguaaagcggccacccggccgcaucATGGTGACCCCCTGTCCCACCAGCC
UTR dot + 25 .(((((((((((((((((((((……(((..(((…..))).)))…))))))))……….)))))))))..))))((((((((.(((.((…(((((…..))))).)).)))))))))))……((((((….))))))….(((((………..)))))…
RS 1 seq AUUAGCUGCCGCGCGUCUGGUGCCCGUUGCAAACCAACGUGGAUAAUCGGGAACACGGUUGAAAUCCGUGACGUGCCCAACGCUGUGAGGUGGACUGGGCGGCAAGGCCACUGGUGCAAACCGGGAAGGCGCCGCUGCGGAGCGAAGCCAAGUCAGAAGACCGGCCAGACGAAACGGGCGUCU
RS 1 dot …..(((((((((((.(((.((.((((((……….(((((((((……)))))…)))))))))).))))))))).))..))))).(((((((((…(((.(((((….)))))…))))))))).)))……(((..(((….))).))).(((((…….)))))
RS 2 seq CUAAAUAUUGUUAUUGCAGGUGACUGUUGAGAACAGUUUAAAAGGGAAUCAGGUGAAAUUCCUGAACGGUCCCGCCGCUGUGAUGGUGAGACAUCUCAUGGUAAAUCCACUGGAUGAGUUCCGGGAAGGAAUGAGGUGUCGAUGAACCAGAGUCAGAAGACCUGCCUGUAAUGUUACACCAUA
RS 2 dot …..(((((((((.((.(((((((((…………………(((((…….)))))))))))..))))).))))))))).((((((((((……(((.(((((…..)))))…)))))))))))))…….(((.(((….))))))..((((….))))…..
RS 3 seq GCGAUAACGCCUGCAUCAGGUGCCCGCCUUGCGGCGGGAGAAUCGGGAACGCGGUGAAAUUCCGCGACGUGCCCAACGCUGUAAGGUGGACGCGUGUUGCCAUAGGCCACUGAGAGAUCGGGAAGGCGGCAACAUGCGAGCGAAGCCAAGUCAGAAGACCGGCCUGAUGCAAUGGACCGAC
RS 3 dot …….((((((…)))))).(((((((((((((((…..((.(..(((((…….))))).).)))))…)))))))))))).(((((((((((….(((.((((….))))…))))))))))))))………..(((….)))(((((………)).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table