Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA019091 Similarity: 0.981 Similarity: 0.981 Similarity: 0.981
UTR: 5HSAA019091
Gene: CCNO_0
MFE: -42.284
ENS: 0.925
Length: 99.
Predicted Ligands:
glycine - 7/20
purine - 4/20
zmp-ztp - 4/20
 RS: URS0000AB7ED7_1263107
MFE: -30.333
Ligand: glycine
Species: Ruminococcus obeum CAG:39 Glycine riboswitch
 RS: URS0000D8986C_1920421
MFE: -18.936
Ligand: purine
Species: Paenibacillus sp. FSL H7-0331 Purine riboswitch
 RS: URS0000D8C254_1906741
MFE: -35.645
Ligand: glycine
Species: Jeongeupia sp. USM3 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA019091 URS0000AB7ED7_1263107 URS0000D8986C_1920421 URS0000D8C254_1906741
Length 99. 100. 100. 100.
Similarity - 0.981 0.981 0.981
Ensemble Norm 0.925 - - -
MFE -42.284 -30.333 -18.936 -35.645
Ligands - glycine purine glycine
Gene CCNO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 2. 3.
Length SE - 1. 1. 1.
Lev Distance - 21. 24. 24.
UBS 6. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 0. 0. 1. 1.
H 3. 3. 3. 3.
BL 2. 4. 2. 2.
BR 2. 3. 1. 2.
UN 0.141 0.170 0.120 0.130

Sequences

Field Description
UTR seq + 25 cacuuucgagugcgcguuugcugcccgccgcagcccgggcguugaagguaguaaagcggccacccggccgcaucATGGTGACCCCCTGTCCCACCAGCC
UTR dot + 25 .((((((((.(((.((…(((((…..))))).)).)))))))))))……((((((….))))))….(((((………..)))))…
RS 1 seq GAUCGUAUCUCUGGAGACGCCUGUUUCAGUACAGGGGCCGAAGGUGCAAGCGACGCGUAAGCGUCUUGAAUCUCUCAGGCAAAAGGACAGAGGAUGCUUU
RS 1 dot ….((((((.(((…(.(((((……))))).)))).))))))….(((((….)))))….(((.(((.(………).))))))…..
RS 2 seq ACUCAUCACUCAUUAUUCAUUCGUAUAACCUCACGACAUUAGGGUGAGGGUCUCUACAGGAAGCCUUAACUUCCUAACUACGAAUAUAGGACAUCUUCGA
RS 2 dot ((((.((((((………((((……..))))…..))))))))))……((((((……))))))…..((((.((…..)).)))).
RS 3 seq AUCAGGCCAAUUGGAGAGAGGCCGGCAACGCCGGUCCACCGAAGGGGCAAUGCGCGGUCCGCCGCGCCAAACUCUCAGGUAAAAGGACAAGGGGAGAGGC
RS 3 dot ….(.((..((((…(.((((((…..))))))).))))..)).)…((((((….))))))….(((((……………..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table