Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA019326 Similarity: 0.969 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA019326
Gene: CCT6B
MFE: -29.901
ENS: 0.941
Length: 119.
Predicted Ligands:
cobalamin - 5/20
TPP - 5/20
SAM - 4/20
 RS: URS0000C7035E_1462996
MFE: -30.718
Ligand: SAM
Species: Paenibacillus yonginensis SAM riboswitch (S box leader)
 RS: URS0000AB79D0_629263
MFE: -29.278
Ligand: cobalamin
Species: Pseudomonas syringae pv. pisi str. 1704B Cobalamin riboswitch
 RS: URS0000BF175B_1609133
MFE: -55.516
Ligand: methionine
Species: Streptomyces sp. NRRL S-495 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA019326 URS0000C7035E_1462996 URS0000AB79D0_629263 URS0000BF175B_1609133
Length 119. 119. 118. 118.
Similarity - 0.969 0.967 0.966
Ensemble Norm 0.941 - - -
MFE -29.901 -30.718 -29.278 -55.516
Ligands - SAM cobalamin methionine
Gene CCT6B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 5.016 15.002
Length SE - 0. 1. 1.
Lev Distance - 41. 41. 39.
UBS 7. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 3.
ILR 2. 3. 2. 2.
H 3. 3. 4. 3.
BL 2. 1. 0. 3.
BR 1. 1. 1. 4.
UN 0.084 0.126 0.212 0.042

Sequences

Field Description
UTR seq + 25 ggccgaggcucaagagagcguggcgucgcauugccguuuuugcucagaaucgcgacuaaggcuuuuuuuuuuucucccucugaacgguuaggcuATGGCTGCGATAAAGGCCGTCAACT
UTR dot + 25 .(((.(.((((….)))).))))…((…(((((((……((((………………….))))……)))))))…)).((((((……..))))))…..
RS 1 seq UUCUUAUCAAGAGAGGCGGAGGGAAAGGCCCGAUGAAGCCCAGCAACCGAUUCAAAUCACGCAUUUGGAUGUCAUGGUGCUAAUUCCUCAGAGUGCGUCGGCAUUCUGGCAGAUGAGAA
RS 1 dot (((((…..)))))….(((((..(((((.((((…((((…..(((….)))……))))…)))))).)))..)))))((((((((….))))))))………..
RS 2 seq UUUACCAUGCCGCGCGUCGGUUUCCGAGAGGAACUAACAGGGAAUUCGCCCGCCUUUUUCCACCAGGCGAAAAACGAAACUGCCCCCGCAACUGUAGGCACCGAGCCUGCUCCAUGAC
RS 2 dot …(((((((…)))).)))((((….))))……(((..((((..(((((………)))))…..))))….)))……..((((((…..))))))……..
RS 3 seq GGUCAUGAGCGACAGCGACAAGCCCCAGCUUGCUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCUGGGUGAGGACCGGGCCGUGCGGCGAGCCGUCCGCGUGGCAAGCGCGGACA
RS 3 dot (((..((.((….))..)).)))…(((((((((.((((…((((..((((.(((…..))).)))).))))…..)))).))))))))).((((((((…..)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table