Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA019415 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA019415
Gene: CD164
MFE: -18.592
ENS: 0.952
Length: 91.
Predicted Ligands:
glycine - 9/20
glutamine - 5/20
guanidine - 1/20
 RS: URS0000BFD885_696747
MFE: -26.651
Ligand: glutamine
Species: Arthrospira platensis NIES-39 Glutamine riboswitch
 RS: URS0000C31D40_513049
MFE: -28.201
Ligand: glutamine
Species: Arthrospira maxima CS-328 Glutamine riboswitch
 RS: URS0000C4C0E4_1127131
MFE: -22.756
Ligand: guanidine
Species: Weissella confusa LBAE C39-2 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA019415 URS0000BFD885_696747 URS0000C31D40_513049 URS0000C4C0E4_1127131
Length 91. 92. 92. 92.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.952 - - -
MFE -18.592 -26.651 -28.201 -22.756
Ligands - glutamine glutamine guanidine
Gene CD164 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.017 8.017 4.
Length SE - 1. 1. 1.
Lev Distance - 24. 24. 27.
UBS 6. 6. 5. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 3. 1. 1. 3.
H 1. 2. 2. 1.
BL 2. 2. 3. 3.
BR 2. 2. 1. 3.
UN 0.099 0.228 0.228 0.109

Sequences

Field Description
UTR seq + 25 ggauugagggguugacugagcguugcgagccuuagcuuucucccgaacgccagcgcugaggacacgATGCGAAAAGGAAGAAAAGTACCCA
UTR dot + 25 ……..((((((.((.((((((((((((….)))……….))).)))))).))..))………………….)))).
RS 1 seq AUCGUUCAUCUCUUUUCGCUCUAAGGGUUUUCGAGCCCAUAAGUUCAGAGGAGGGGAGACGGAAGUAGGGAGUAAUCCCGAAGGAACGCGCC
RS 1 dot ….(((.(((((((((.(((((((((((….)))))…..)).))))))))))))).)))….((((….))))………….
RS 2 seq AUCGUUCAUCUCUUUUCGCUCUAAGGGUUUUCUAGCCCUAAUGUUCAGAGGAGGGGAGACGGAAGUAGGGAGUAAUCCCGAAGGAACGCGCC
RS 2 dot ….(((.(((((((((.((((.((((((….))))))…….))))))))))))).)))….((((….))))………….
RS 3 seq UAAAAAGUUUGCUAGGGUUCCGCACGCAGUGGUCUGGUCAAAGAGCAAACGCGUGCCUCGCACGUACACGGAAGGAUAAAAGCCUGGGAGUU
RS 3 dot ……..((.(((((.((((((((((..((.(((……))).))…))))))……………..)))….).))))).))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table