Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA020282 Similarity: 0.947 Similarity: 0.946 Similarity: 0.942
UTR: 5HSAA020282
Gene: CDC42
MFE: -66.035
ENS: 0.961
Length: 191.
Predicted Ligands:
lysine - 13/20
cobalamin - 4/20
Mg2+ - 1/20
 RS: URS0000AB4BB9_457570
MFE: -53.251
Ligand: Mg2+
Species: Natranaerobius thermophilus JW/NM-WN-LF M-box riboswitch (ykoK leader)
 RS: URS000231306E_149040
MFE: -66.077
Ligand: TPP
Species: Phialocephala scopiformis TPP riboswitch (THI element)
 RS: URS000231B0EE_1263106
MFE: -50.906
Ligand: cobalamin
Species: Ruminococcus gnavus CAG:126 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA020282 URS0000AB4BB9_457570 URS000231306E_149040 URS000231B0EE_1263106
Length 191. 192. 191. 190.
Similarity - 0.947 0.946 0.942
Ensemble Norm 0.961 - - -
MFE -66.035 -53.251 -66.077 -50.906
Ligands - Mg2+ TPP cobalamin
Gene CDC42 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 28.002 7.001 12.001
Length SE - 1. 0. 1.
Lev Distance - 55. 69. 70.
UBS 12. 13. 12. 11.
BS 0. 0. 0. 0.
ILL 1. 4. 2. 3.
ILR 5. 4. 4. 4.
H 4. 3. 3. 3.
BL 4. 4. 4. 3.
BR 1. 5. 3. 3.
UN 0.099 0.052 0.131 0.132

Sequences

Field Description
UTR seq + 25 acuuccgcgggcacccaacugugcgucuccugcgcgcugacgucaggugcgugccccuguccggcagccgaggagaccccgcgcagugcugccaacgccccgguggagaagcugaggucaucaucagauuugaaauauuuaaaguggauacaaaacuauuucagcaATGCAGACAATTAAGTGTGTTGTTG
UTR dot + 25 ..((((((((((…((((((((((((((((.((.((((.((.((((……..))))..)).)))))))))))))…)))))))..))…..))))..))))))…((((……..))))…………..((((((……..))))))((((((((((……….))))))))))
RS 1 seq UUAUAAACUCGUUAGGUGAGGCUCCUGGGUGGAUAUAAGCUGCUGCCCAAAAACGUCGAGAGACGCCAAUGGGUAUAACAGACAGUGUCGGCUUAAGGCCUGUCUAAUGCAGCUGGUCCUCUUCUACCUUAUUAGAUAUUAAAUUUCGGAUCUACGUCACCCAGUGCCAAAGCUAAGACGAGGAGUGCGUAA
RS 1 dot …….(((((((((..(((((..(((((.(((((…(((.((((((….((((….))))….))))))…)))…))))).))))).))))).))))))).))..(((((……………………….)))))((((.(((((.((…………))..)).))))))).
RS 2 seq AAAAGCAUGGCGGGUGUUCUGUUUCCUUUUGCACUGCAUUCCAAUCUCUCUCAUCUAUCUGCAUCAAUUCAAUUGAUCAGAUGGCAUAUGCGAGGACUUGGGGUGAGGUGUAGAAGGAUUCGGAUCUGAGAAUAUACCGUUCAAAACUUGAUCUAGAUAAUUCUAGCGAAAGGACAUGCUUUCCCCUAUUC
RS 2 dot …….(((..(((((((((..((((((((((((.((((((((((.(((.((((((((((.((((((…)))))))))))))…))).))))).)))))))).))))))))))))..))))………)))))..)))………(((((….))))).(((((……)))))……..
RS 3 seq AUUCAAAGCAGAUUUAAAAGAUGCCGUCCGAAAAAAGGCGGCAGGGGAACCGGGUGGGAAUCCCGGACAAUGCCCGUUGCUGUAUUGGAGUAGUGGUAUUUCAUGAGGUCACUGUAGGAAAUCCUAUGGGAAGGCGAAAUACUGUGUUUGAUGCCUAAGUCAGAACACCCGCUUUUAAAGGAAUCUGGAA
RS 3 dot ……….(((((…(((((((((((((…..((((((.(((.(.(((((…….)))))….).)))))))))…)))))….))))))))….))))).(((((((….)))))))(((((((…….(((((((((……)))))).))).)))))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table