Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA020479 Similarity: 0.950 Similarity: 0.948 Similarity: 0.948
UTR: 5HSAA020479
Gene: CDH19
MFE: -23.890
ENS: 0.821
Length: 163.
Predicted Ligands:
TPP - 10/20
cobalamin - 6/20
glucosamine - 1/20
 RS: URS0000C569D6_1460663
MFE: -52.213
Ligand: TPP
Species: Paraphaeosphaeria sporulosa TPP riboswitch (THI element)
 RS: URS0000C3AF7A_1126212
MFE: -44.
Ligand: TPP
Species: Macrophomina phaseolina MS6 TPP riboswitch (THI element)
 RS: URS0002324B8D_698759
MFE: -59.951
Ligand: cobalamin
Species: Streptomyces ipomoeae 91-03 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA020479 URS0000C569D6_1460663 URS0000C3AF7A_1126212 URS0002324B8D_698759
Length 163. 166. 161. 161.
Similarity - 0.950 0.948 0.948
Ensemble Norm 0.821 - - -
MFE -23.890 -52.213 -44. -59.951
Ligands - TPP TPP cobalamin
Gene CDH19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 10.002 21.010
Length SE - 9. 4. 4.
Lev Distance - 53. 59. 54.
UBS 11. 11. 13. 9.
BS 0. 0. 0. 2.
ILL 1. 1. 2. 0.
ILR 0. 1. 2. 2.
H 3. 4. 3. 3.
BL 7. 6. 6. 5.
BR 5. 5. 5. 3.
UN 0.086 0.102 0.043 0.186

Sequences

Field Description
UTR seq + 25 aacuucuagaaguugaaguuacaaagguauauagaagguacacagaaucagaaaagauuauaaaagaaagcaagauuuuuguuagugacguccuguuuccucugaagaguaauaguuggaaucaaaagagucaacgcaATGAACTGTTATTTACTGCTGCGTT
UTR dot + 25 ((((((……..)))))).((.(((.(.((((.(.((.(((..((.((((((…………………)))))))).))))).).)))).)))).))..(((((((((((……………………)))))))))))………..
RS 1 seq AGCAUGCAUGGCGGGUGUUCAAGCUCGUUUUCAAUCCCUCGUAUCCGUCAGAGAUUCUCAACAUCUCCUCACAGCUACGAUGGACUGGAGACGAGCUUGUUCUGAGAUCAUACCGUUCAAACUUGAUCUGGAUAAUUCCAGCGAAAGGACUAGCUGCUUCUUGAUC
RS 1 dot (((((.(…..).)))))((((((((((((((.(((.(((((.(.((..(((((…….)))))…)).).))))).))).)))))))))))))).(((.((((((………….)))))))))……((((……….))))……….
RS 2 seq UGAUGCAUGAACCGGUGCUCGAGCUUUUUGCUAUCUUUGUCGCAUACUCAUUGCCAACUCAAUUGGGUUUGCGACGGAGUUAUCAGGAGUUCUUGCUGAGAUUAUACGGUUGAACUUGAUCAGGAUAAUACCUGCGUCGAAGAAUCAUGCUCCUCGCCCAU
RS 2 dot .((.((((……))))))(((((.((((.((.((((((((((.((((((((……)))).)))).)))))))))).)).)))))))))..((.(((…….((((….(((((((((……)))).)))))..))))……)))))….
RS 3 seq GCUUCGCGGUACCUUCACGGCGAUAUUGACGACGGCAAGACGGAAGCCCGGUGAGAGUCCGGCACGGUCGCGCCACUGUAAGCCCAGCACCAUCUGCCCGGCUCCACCGGGCAGAUGUACGCGAAGCAAGUCAGACCCGUAGCCGUCGUACCGAGCACCAC
RS 3 dot …((((.((……)).))))…..((((((((…((((..((((((((.(((((.((((.(((.((((……..))…)))))…)))).))))))))))))).(((………….)))….)))).))))))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table