Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA020573 Similarity: 0.982 Similarity: 0.982 Similarity: 0.980
UTR: 5HSAA020573
Gene: CDK5
MFE: -30.799
ENS: 0.995
Length: 86.
Predicted Ligands:
GMP - 14/20
homocysteine - 3/20
zmp-ztp - 2/20
RS: URS0000D6808A_12908
MFE: -32.727
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
RS: URS0000D68D97_12908
MFE: -39.470
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
RS: URS0000D6890E_12908
MFE: -30.544
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA020573 URS0000D6808A_12908 URS0000D68D97_12908 URS0000D6890E_12908
Length 86. 84. 85. 86.
Similarity - 0.982 0.982 0.980
Ensemble Norm 0.995 - - -
MFE -30.799 -32.727 -39.470 -30.544
Ligands - GMP GMP GMP
Gene CDK5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 2.003 5.002
Length SE - 4. 1. 0.
Lev Distance - 19. 23. 25.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 0. 0. 0. 1.
H 1. 1. 1. 1.
BL 5. 4. 4. 4.
BR 4. 3. 4. 5.
UN 0.233 0.179 0.176 0.186

Sequences

Field Description
UTR seq + 25 ugcaacgccggggccagagucuuaaaaccgagggcccgcagggguccccgcggccgccgcgATGCAGAAATACGAGAAACTGGAAA
UTR dot + 25 ((((.(((.(.((((.(………..((.((((((….)))))).))))))).).))).))))………………..
RS 1 seq UCUCACGCGGGGGCUCUGACACGCGGCCCACACUCCGGCCGCCCGGACCGCGCCGAGCCACCGGCGAGACCGACCCGCGCAUGG
RS 1 dot ((((.(.(((.(((((.(…(((((…….(((((….))))))))))).))))).)))).))))……………
RS 2 seq GGUCUGGCGGGAGGCUCUGACACGCGGUCCAAACCCCGGCCGCCGGGACCGCGCCGAGCCACUGGCGAGACGGACCCGUCUGAUC
RS 2 dot .((((.((.((.(((((.(…((((((……(((((…)))))))))))).))))).)).)).))))…………..
RS 3 seq CCGUUGGCGGGAGGCUCUGACACGCGGCCCAAAGCCCUGGCCGCCGGGACCGCGCCGAGCCACUGGCGAGACCGACCCGUUGCAGC
RS 3 dot ..(((.((.((.(((((.(…((((((((…((…….)).))).)))))).))))).)).))..)))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table