Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA020574 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA020574
Gene: CDK5_0
MFE: -20.594
ENS: 1.
Length: 71.
Predicted Ligands:
fluoride - 9/20
Ni/Co - 3/20
homocysteine - 2/20
 RS: URS0000D9C2AD_1805131
MFE: -19.898
Ligand: fluoride
Species: Elusimicrobia bacterium CG1_02_37_114 Fluoride riboswitch
 RS: URS0000BF7882_1655597
MFE: -10.642
Ligand: SAM
Species: Rhodobacter sp. BACL10 MAG-120910-bin24 SAM-V riboswitch
 RS: URS0000D681DF_12908
MFE: -25.609
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA020574 URS0000D9C2AD_1805131 URS0000BF7882_1655597 URS0000D681DF_12908
Length 71. 70. 70. 73.
Similarity - 0.985 0.984 0.983
Ensemble Norm 1. - - -
MFE -20.594 -19.898 -10.642 -25.609
Ligands - fluoride SAM Ni/Co
Gene CDK5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.076 2.004 9.025
Length SE - 1. 1. 4.
Lev Distance - 14. 20. 15.
UBS 5. 2. 5. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 0. 0.
H 3. 2. 3. 3.
BL 2. 0. 1. 0.
BR 1. 0. 1. 0.
UN 0.239 0.514 0. 0.397

Sequences

Field Description
UTR seq + 25 agagucuuaaaaccgagggcccgcagggguccccgcggccgccgcgATGCAGAAATACGAGAAACTGGAAA
UTR dot + 25 …………..(.((((((….)))))))(((((…))))).(.(((…………))).)..
RS 1 seq AAAUUAAAAGGUGAUGAGGUUCGCCUACGAACCACCCCGAUAAAUCGGGGUUGAUGACCUCUACUCUGAA
RS 1 dot ……………..((((((….))))))(((((((….)))))))……………….
RS 2 seq AUCAAGAUCAGGCAUUUAACAACUAACUUGUGCGCCUUGCCAUUAUGGCUAAAGCACUAAAGCGGAGUAA
RS 2 dot ………((((.(…((((…..))))).)))).((((…))))….((……))…….
RS 3 seq AUUAUAAAAACUGAACAGACCGGUUUCUGCCGGUCGGGUCACAAACGUGACAGUGGAUUCCCACGGGACAGUC
RS 3 dot ……………..(((((((….)))))))..(((((….))))).((((….))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table