Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA020778 Similarity: 0.969 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA020778
Gene: CDYL2
MFE: -44.842
ENS: 0.773
Length: 130.
Predicted Ligands:
cobalamin - 7/20
TPP - 5/20
FMN - 3/20
 RS: URS0000DB36F1_1817896
MFE: -21.699
Ligand: glucosamine
Species: candidate division WS6 bacterium RIFOXYB1_FULL_33_14 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000DAF1DA_1034889
MFE: -55.067
Ligand: zmp-ztp
Species: Variovorax sp. HW608 ZMP/ZTP riboswitch
 RS: URS0000C54231_1168221
MFE: -45.921
Ligand: TPP
Species: Coniosporium apollinis CBS 100218 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA020778 URS0000DB36F1_1817896 URS0000DAF1DA_1034889 URS0000C54231_1168221
Length 130. 129. 128. 131.
Similarity - 0.969 0.965 0.965
Ensemble Norm 0.773 - - -
MFE -44.842 -21.699 -55.067 -45.921
Ligands - glucosamine zmp-ztp TPP
Gene CDYL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.010 6.006 4.003
Length SE - 1. 4. 1.
Lev Distance - 39. 40. 45.
UBS 9. 8. 10. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 0. 2. 1.
H 5. 4. 5. 5.
BL 3. 2. 3. 2.
BR 3. 2. 2. 2.
UN 0.154 0.256 0.078 0.099

Sequences

Field Description
UTR seq + 25 acacacgcgcgcacacacacgcgcacaccggaccccgcgcgcacacgcacggagggcgcgagcgagcagacgcgcacaccggcgagccaaguuccgcagccuggcATGGCTTCTGGGGACCTTTACGAGG
UTR dot + 25 ……(((((……..)))))……..(((((.(((….))).))).))(((((……….)))))…((((.((((((.(((………))).))))))))))…((((…))))
RS 1 seq AUAUAUAUAUUAGCGGCUGGGUCUAAUAGACUACGAGGAGAAGGUUAUCGAGUUAUCAGCGGAUGCCUUCAGGUUCAUGUAUAAACCUAAAUGAGAUUACAAAUACACAGAGUAUCUCUAAAUACAUUU
RS 1 dot …….(((((((……).))))))………..(((((.((((..(((…))).)))))))))(((((……..)))))….((((.(((………..)))))))………..
RS 2 seq CGGCGGGCACGCGACUGGCGAUAGGCGCUGCACUUUUUCAGGUGCGUUGCGCUGACGUGGACUACCACUGGGGAGCGUGCUGCCUGCGGUCUCGAGCAGGUGUUCAGCCGUUCGCCUGGGCAGCCCUU
RS 2 dot ((.(((……..))).))…((((((((((((….)))))))..)))))…((((….)))).((.(((((.(((((((((……..)))))….))))))))).)).(((…)))..
RS 3 seq CGGCUUCACUACGGGCGCCGAAUCCACACCAUCCGUAACAGUUCGUUGCGGAUGGCGCGGACGAAGCUGAGAUGUACCGUGAUUACUCGAUCAAGAUAAUGCUUGCGUGAGGAACGUGCUGCCGCGCUUCU
RS 3 dot ((((.((……)).))))……..(((((((((((…..)))))))))))(((((((………..)).)))))….((((..((((……))))..))))(((.((((….))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table