Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021116 Similarity: 0.936 Similarity: 0.935 Similarity: 0.935
UTR: 5HSAA021116
Gene: CEP70
MFE: -59.285
ENS: 0.862
Length: 228.
Predicted Ligands:
cobalamin - 18/20
glucosamine - 1/20
Mn2+ - 1/20
 RS: URS0001A0377C_2682968
MFE: -82.145
Ligand: cobalamin
Species: Hyphomicrobium sp. ghe19 Cobalamin
 RS: URS0000BE237F_1134406
MFE: -72.833
Ligand: glucosamine
Species: Ornatilinea apprima glmS glucosamine-6-phosphate activated ribozyme
 RS: URS00019CE05C_2038394
MFE: -87.510
Ligand: cobalamin
Species: Roseovarius sp. EC-HK134 Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021116 URS0001A0377C_2682968 URS0000BE237F_1134406 URS00019CE05C_2038394
Length 228. 227. 228. 227.
Similarity - 0.936 0.935 0.935
Ensemble Norm 0.862 - - -
MFE -59.285 -82.145 -72.833 -87.510
Ligands - cobalamin glucosamine cobalamin
Gene CEP70 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 6.001 7.004
Length SE - 1. 0. 1.
Lev Distance - 83. 84. 82.
UBS 16. 15. 17. 15.
BS 0. 0. 0. 0.
ILL 4. 5. 6. 5.
ILR 4. 5. 4. 5.
H 6. 6. 6. 6.
BL 3. 4. 4. 3.
BR 3. 3. 3. 1.
UN 0.162 0.132 0.136 0.097

Sequences

Field Description
UTR seq + 25 auaagccuccauguaagugacagggcacccaaggagugcguuggaagcgccagcgugcccgagaccagcacaucgcaccgacgccuucguuugcgaugaagauccaguuucagacaugagacucguugggugaucauuucauugagaucaaccugaaugaccagguguaaagugcaagaguaauaugcuaugacugaguaacuATGTTTCCGGTAGCCCCTAAACCCC
UTR dot + 25 ….((((.(((….)))…))))……((.(((((((((…..)))))))))))……….(((((((..((((….)))))))))))……..((((((….))))))(((((((((((((……….))))).))).)))))..(((.((….(((..(((..(((((((…….))))..)))..)))..))))).)))…….
RS 1 seq UGCUUAUGGCGAUGUGACGGUUCCAUUCGCGUCAAGUCGCGCGGAUGGUGAAAAUGGGAACGCGGUGCGACACCUUUGGUGUCAAUGCCGAGACUGCCCCCGCAACUGUAAGCGGCGAGUCCGCUCCGGUUAUACCACUGACGGCCUCAUUCUGGAGGCCCUCGGGAAGGUCGGAGAAGACGCUUGAGCCGCAAGUCAGGAGACCUGCCAUCACAAGCUGCCCAUCU
RS 1 dot ((((…))))………..((((((((((……))))))))))…….(((..(.((((..((((((…))))))…)))).)….)))((((……..))))…(((..(((((…..(((.((((.((((((……)))))).))))…))))))))..)))(((((….(((.(((….))).)))…..)))))………
RS 2 seq AUUUGGGAAAUAGCGGCUGAGUCUCGAUCGAUACGGCGGAAGCCAAUCGAGAUGACGAGGUGGAGGUUCCUCUCCGCGAGGAGAGAGCUAACUUUGGGUAACUCCAAAGGAAAAUCGAAAGAUCAGCGGGUGCCUCUGAAGCCUGAUCACGGGUUUCUUUUCCCCCAUAUUCACACGAUCUCAAAAGCAGAUGGUGACGUCUGCCACAAAGAAAGUGUAGUGAUCUAC
RS 2 dot ………….(.(((..(((((..(((((..(((….))).))))))).)))..))).).((((.((((((….))))))))))..(((((((….)))))))….(((….)))….(((.(…..((((((((….))))))))…..)))).((((.((((..(((…..(((((((….)))))))…..)))..))))))))……
RS 3 seq UGCAUACCGGACGUGCAAGGUUCCUCGUUUGGGUGCAAAGCGCCUCGGGGAUGAAAUGGGAAUGACGUGCCGGUGGACCCAAUUAGGGCGCCUAUGCGUCAGCCGCCCCCGCGACUGUAAGCGGCGAGCCCCUGCCAGAUGCCACUGAGGUGCCUAUGACCUUGGGAAGGCGGCAGACAGGCGACGACCCGCGAGCCAGGAGACCAGCCCUGCGUUCGUCAAUCCCG
RS 3 dot (((((…….)))))….((((((…((((((…))))))))))))……(((..(((((((..((((..(((…..)))))))..)))))))….)))((((……..))))((.(((.(((((….(((.(((((((…….)))))))…))))))))…)))..))….((((((((((……..)))).))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table