Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021157 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA021157
Gene: CEP97
MFE: -13.951
ENS: 0.725
Length: 52.
Predicted Ligands:
glutamine - 12/20
SAM - 5/20
unknown - 3/20
 RS: URS0000C437D4_12908
MFE: -10.186
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C2AD38_12908
MFE: -9.953
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C22C49_12908
MFE: -9.667
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021157 URS0000C437D4_12908 URS0000C2AD38_12908 URS0000C22C49_12908
Length 52. 51. 51. 51.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.725 - - -
MFE -13.951 -10.186 -9.953 -9.667
Ligands - glutamine glutamine glutamine
Gene CEP97 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 8.002 8.002
Length SE - 1. 1. 1.
Lev Distance - 13. 14. 14.
UBS 6. 5. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 0. 2. 2.
H 2. 2. 2. 2.
BL 2. 0. 1. 1.
BR 3. 3. 1. 1.
UN 0.038 0.039 0.078 0.078

Sequences

Field Description
UTR seq + 25 gccugguauuauuagcaagcagcaaauATGGCGGTGGCGCGCGTGGACGCGG
UTR dot + 25 ((((.((..((((.((…..)).))))..)).).))).((((….)))).
RS 1 seq AUCGUUCAACUCUGAGGAGUCGGAAGUAAGCGAAAGCUGAAGGAACGCGCU
RS 1 dot .(((((..(((((((….))))).)).))))).(((((……)).)))
RS 2 seq AUCGUUCAUCUCUUAGGAGACGGAAGUAGGUGAAAACCGAAGGAACGCCGC
RS 2 dot .(((((((((((((.(….)..))).)))))))…))).((….))..
RS 3 seq AUCGUUCAUCUCUUAGGAGACGGAAGUAGGUGAGAACCGAAGGAACGCCAC
RS 3 dot .(((((((((((((.(….)..))).)))))))…))).((….))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table