Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021163 Similarity: 0.944 Similarity: 0.940 Similarity: 0.939
UTR: 5HSAA021163
Gene: CEPT1
MFE: -48.677
ENS: 0.986
Length: 195.
Predicted Ligands:
cobalamin - 19/20
lysine - 1/20

 RS: URS0002312A03_469383
MFE: -79.496
Ligand: cobalamin
Species: Conexibacter woesei DSM 14684 Cobalamin riboswitch
 RS: URS000231794E_99158
MFE: -65.808
Ligand: cobalamin
Species: Hammondia hammondi Cobalamin riboswitch
 RS: URS00023267F3_1214787
MFE: -77.145
Ligand: cobalamin
Species: Paracoccus sediminis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021163 URS0002312A03_469383 URS000231794E_99158 URS00023267F3_1214787
Length 195. 194. 195. 194.
Similarity - 0.944 0.940 0.939
Ensemble Norm 0.986 - - -
MFE -48.677 -79.496 -65.808 -77.145
Ligands - cobalamin cobalamin cobalamin
Gene CEPT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.027 27.009 15.022
Length SE - 1. 0. 1.
Lev Distance - 63. 66. 73.
UBS 13. 15. 15. 12.
BS 0. 0. 0. 0.
ILL 1. 4. 4. 3.
ILR 1. 3. 4. 2.
H 5. 4. 3. 6.
BL 4. 4. 4. 2.
BR 5. 4. 6. 3.
UN 0.241 0.077 0.144 0.093

Sequences

Field Description
UTR seq + 25 aaucgcgaaagugucgugaacgugcugccgccgaucagucacccagucggcuggagucggaggcgauauuucuagggguguacuuguuggggucaggguaagcaccagccacaaaaaccuacaaaagaagggaaauuacugucuuuaaauauuaaaaaaaaacaagauccATGAGTGGGCATCGATCAACAAGGA
UTR dot + 25 ..((((((…..))))))…..(((((.(((((.((((((((……(((((((((….))))…)))))))))).))).))))))).)))(((……..)))………….(((((.((…….)).)))))……………….((((.(((……))).))))……..
RS 1 seq CAGCUCGUUAUGCUCGGGGCCAACGGUCGGUGUCGAGGGAAGUCUGGUGCGAAUCCAGCGCGGUCCCGCCACUGUGACCGGGUUCACGCUCGCCGCAAGCCGAUGGCAAGCCACUGGGUCCUCCACUGCGGACCUGGGAAGGCGCGGCGAGUACGCCCGGGAGCCAGGAGACCUGACUCCGGCCAGCUGAGAAC
RS 1 dot .(((…….)))(((((((..(((((((((.((.(((..((((((…….)))).))..))))).))))..)))))))))).))((((((((………….(((.((((((((……..))))))))…)))))))))))…(((..((((.((((…)))).)))))))………..
RS 2 seq CCUAUCAAUUUCGGCGACGGUUCCCUUCGGGGAUCAAAAGGGAAUGCGGUGCGAGGGUAACCCAAUGCCGCAGCUGUCCCCGCAACUGUAAACGGCGAGCCUUUCGUCAAUUUGCCACUGGGCUACUCAGCUCGGGAAGGCGUCAACAGGCGAUGACCCGUGAGCCAGGAGACCUGCCGUCAGUCGUGGUCACAC
RS 2 dot …………(((((.((((((((((((((((……((..((((((….(((…)))…)))))).))))))))).))……..)).)))))..)))))…..(((.(((((((….)))))))…)))…….(((.(((((…((((.((((…)))).).)))))))).)))….
RS 3 seq CUAAGGCAGCCCUGCCUCGGUUCCGGGUUUGCCCCCGGUUAAAAGGGAACGCGGUGCAAAUCCGCGACUGCCCCCGCAACUGUCAGCGGAGAGCGAGGCCGGAUCAACGCCACUGUCCCCCGCAUCGGGGAUGGGAAGGCCCGGCCAAGCGACGACCCGCAAGUCAGGAGACCUGCCGAACGCGAUCACCCUGA
RS 3 dot …(((((….)))))(((((.(((((((((..((((((…….))).))).))))))))).)))))…((((……..))))…….((((((……(((.((((((((……))))))))…)))))))))..(((……)))…(((((…..(((…..)))…..)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table