Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021217 Similarity: 0.980 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA021217
Gene: CES3
MFE: -25.098
ENS: 0.833
Length: 98.
Predicted Ligands:
TPP - 11/20
glycine - 3/20
purine - 3/20
 RS: URS0000C36538_1576605
MFE: -36.268
Ligand: glycine
Species: Streptomyces sp. 150FB Glycine riboswitch
 RS: URS0000C2DBBC_1442371
MFE: -22.047
Ligand: TPP
Species: Fonsecaea multimorphosa CBS 102226 TPP riboswitch (THI element)
 RS: URS0000C6CC9E_866895
MFE: -24.511
Ligand: TPP
Species: Halobacillus halophilus DSM 2266 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021217 URS0000C36538_1576605 URS0000C2DBBC_1442371 URS0000C6CC9E_866895
Length 98. 99. 98. 98.
Similarity - 0.980 0.978 0.978
Ensemble Norm 0.833 - - -
MFE -25.098 -36.268 -22.047 -24.511
Ligands - glycine TPP TPP
Gene CES3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 7.007 10.
Length SE - 1. 0. 0.
Lev Distance - 24. 27. 26.
UBS 6. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 5.
ILR 2. 3. 2. 4.
H 2. 2. 2. 2.
BL 0. 1. 2. 0.
BR 1. 2. 2. 0.
UN 0.092 0.040 0.173 0.082

Sequences

Field Description
UTR seq + 25 gagaucgguggugcugaagggcagggaucuuauuccaccuucugaagcuucugucgaaccaguuguaaggagaATGGAGCAGATGAGCCGGGAGGACA
UTR dot + 25 ((((((…..((((….))))..))))))……(((((((..((((((((….(((………….))).)))))..))))))))))…
RS 1 seq UGACCCCGUGCGGGAGAGUCCUCCGGUCAAGUUCGCCGGUGGCGCCGAAGGAGCAAAUCCUCCCCGGAAUCUCUCAGGCCCCCGUACCGCGCGGACGAG
RS 1 dot (((((…….((((….))))))))).((((((((((((.(((…((((….(((…..)))..))))..))).))…)))).))))))…
RS 2 seq AGUUCCACUUGCUGGAGUCUGGGACAGUCGCGUUCUGAGAUCAUACGGUUUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUUAUGCGAUCUCUUCUC
RS 2 dot .(((((((((….))))..)))))………..((((((.((.((((…(((…((((……))))…))))))).)).))))))…..
RS 3 seq AAGCUCUACUAGGGGUGCCUUCGGGCUGAGACAAAUGCGUUUGAACCCUAGAACCUGAUCUGGACGAUACCAGCGUAGGAAAGUAGAGGGUGUAGCAU
RS 3 dot .(((((….(((….)))..)))))…….((((..(…(((((….((((..((((……))))..))))…….))))))..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table