Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021229 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA021229
Gene: CETN2
MFE: -21.267
ENS: 0.839
Length: 72.
Predicted Ligands:
fluoride - 14/20
2'-dG-II - 5/20
SAM - 1/20
 RS: URS0000BE6140_699246
MFE: -11.326
Ligand: fluoride
Species: Clostridiales genomosp. BVAB3 str. UPII9-5 Fluoride riboswitch
 RS: URS0000D908E8_1121306
MFE: -14.676
Ligand: fluoride
Species: Clostridium collagenovorans DSM 3089 Fluoride riboswitch
 RS: URS0000DA12B9_1801960
MFE: -16.378
Ligand: fluoride
Species: Planctomycetes bacterium RBG_13_44_8b Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021229 URS0000BE6140_699246 URS0000D908E8_1121306 URS0000DA12B9_1801960
Length 72. 72. 72. 74.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.839 - - -
MFE -21.267 -11.326 -14.676 -16.378
Ligands - fluoride fluoride fluoride
Gene CETN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 3.007 4.
Length SE - 0. 0. 4.
Lev Distance - 20. 20. 16.
UBS 4. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 0. 0. 1.
H 2. 3. 2. 2.
BL 2. 1. 1. 1.
BR 2. 1. 1. 1.
UN 0.333 0.389 0.417 0.351

Sequences

Field Description
UTR seq + 25 aguguacacgucgguugccuaacaaccggcagcggacuccuuuggcuATGGCCTCCAACTTTAAGAAGGCAA
UTR dot + 25 ………(((.((((((……..)))))).)))………….((((.(……..).))))..
RS 1 seq AUGAAAAAAGGGAAUGAAGUUCUCCCUUGGGCAACCUGAACCGCUUUUUAAGCUGAUGACUUCUGCGAUAAA
RS 1 dot …….((((((………))))))((….))……………((.((…..)).))……
RS 2 seq GAGAUAUGAGGAGAUGAAGCUCUCCUGAUAAACUUUAUCAAACUGCUAAAUGCUAAUAGCUUCUACGACCUG
RS 2 dot ….(((.((((((……)))))).)))…………..((((……..))))…………
RS 3 seq AGAUAAGGCGGUGAUGAGGUUCACCAAAUAACCGCCCUUAAAAUAAUAAUAGGGAUGAUAACCUCUACUGACAG
RS 3 dot ……((((((.((..((….))..)).))))))………….(((((……..)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table