Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021230 Similarity: 0.981 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA021230
Gene: CETN2_0
MFE: -28.868
ENS: 0.946
Length: 92.
Predicted Ligands:
TPP - 8/20
tetrahydrofolate - 2/20
glutamine - 2/20
 RS: URS0000DB1D45_1907416
MFE: -18.589
Ligand: TPP
Species: Aeromonas sp. RU39B TPP riboswitch (THI element)
 RS: URS0000D9B571_1432788
MFE: -20.953
Ligand: tetrahydrofolate
Species: Streptococcus cuniculi THF riboswitch
 RS: URS0000C092FD_1679169
MFE: -23.154
Ligand: glycine
Species: Bacillus sp. FJAT-27916 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021230 URS0000DB1D45_1907416 URS0000D9B571_1432788 URS0000C092FD_1679169
Length 92. 93. 90. 93.
Similarity - 0.981 0.978 0.977
Ensemble Norm 0.946 - - -
MFE -28.868 -18.589 -20.953 -23.154
Ligands - TPP tetrahydrofolate glycine
Gene CETN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 7. 5.019
Length SE - 1. 4. 1.
Lev Distance - 21. 22. 28.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 0.
ILR 1. 2. 2. 2.
H 3. 3. 3. 2.
BL 3. 3. 2. 3.
BR 3. 0. 1. 2.
UN 0.065 0.043 0.044 0.204

Sequences

Field Description
UTR seq + 25 ggugggaacggcgccgagucaguguacacgucgguugccuaacaaccggcagcggacuccuuuggcuATGGCCTCCAACTTTAAGAAGGCAA
UTR dot + 25 ((((…….)))).((((((.(…..(((.((((((……..)))))).)))..).))))))…((((.(……..).))))..
RS 1 seq GACGCUCAAACGGGGUGCAGACAUACCUGCUGAGAUUAUACCCGUAGACCUGAUCCAGAUAAUGCUGGCGGAGGAAUUUGAGGCCUGACGCGC
RS 1 dot ..(((((…..)))))(((.(((…..(((.(((((…………))))))))…))))))(((.(((………)))..)))..
RS 2 seq CACAGAGUAGGUGGUUUGCGUUAAGUGUGUAUGGAUGGGAUGUUGCCAUACAACGAAGCGAAAGCGCGGUAAACCAUUGCAUCCGCUGUC
RS 2 dot (((…….)))((((.((((..((.(((((((..(…..)..)))))))))..)))).))))((((………….))))….
RS 3 seq AUGAAGGCAAGGGGAGAGACCGCAGGCUGCGGCGCCGAAGGAGCAAACGGCUGAGACCGUGAAUCUCUCAGGCAAAAGAACACUUGCUGGACG
RS 3 dot ………….((((((.(((.((((.(((((((….).))…..)))))).)))))..)))))).(((((……..)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table