Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021234 Similarity: 0.962 Similarity: 0.962 Similarity: 0.961
UTR: 5HSAA021234
Gene: CETN3
MFE: -47.449
ENS: 0.868
Length: 150.
Predicted Ligands:
FMN - 18/20
molybdenum - 1/20
unknown - 1/20
 RS: URS0000D9B058_1798275
MFE: -41.632
Ligand: FMN
Species: Gammaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_36_30 FMN riboswitch (RFN element)
 RS: URS00004C944B_266117
MFE: -70.142
Ligand: FMN
Species: Rubrobacter xylanophilus DSM 9941 FMN riboswitch (RFN element)
 RS: URS0000ABB3A3_697329
MFE: -44.844
Ligand: FMN
Species: Ruminococcus albus 7 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021234 URS0000D9B058_1798275 URS00004C944B_266117 URS0000ABB3A3_697329
Length 150. 151. 150. 150.
Similarity - 0.962 0.962 0.961
Ensemble Norm 0.868 - - -
MFE -47.449 -41.632 -70.142 -44.844
Ligands - FMN FMN FMN
Gene CETN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 8.004 7.011
Length SE - 1. 0. 0.
Lev Distance - 49. 48. 49.
UBS 10. 10. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 1. 1. 2.
H 6. 5. 5. 5.
BL 2. 2. 1. 0.
BR 3. 4. 2. 3.
UN 0.140 0.232 0. 0.247

Sequences

Field Description
UTR seq + 25 auguugugggaggucccugaggccgcugaggucguucgugucuguugaacggcugugggcgucuugcugccuuggguaggggguuaaaaucguucuugagaggaacgucucugugcgaagagauaATGAGTTTAGCTCTGAGAAGTGAGC
UTR dot + 25 ..(((..(((…..)))..)))((((.((((((((((…….))))))))).).)))).(((.(((((…))))).)))…….(((((((…)))))))(((((……)))))………..((((……..))))
RS 1 seq CAUUAUCUUCAGGGCGGGGCGCAAUUCCCCACCGGCGGUAUUUUUAUUUUGAAAUAAAAAAGCCCGCGAGCGAUUUGUGAUUUAAUGCACAAAAAGCAGAUCUGGUUUAAUGCCAGAGCCGACGGUAUAGUCCGGAUAGGAGAAGAUAAAA
RS 1 dot …………((.((((…….)))).)).(((((.((((((((….)))))))).))).))..((..((((((……..))))))..))…((((((…..)))))).(((((……))).))…………….
RS 2 seq GGUAACUUUCGGGGGCGGGUGGAAUUCCCGCACCGGCGGUGAGCCCGGGUCCAGCGCGCCCGGGGAGCCCGCGACCCCCCGCCGCAGGCGGGGGUGGAGCCGGUGAGAGUCCGGCGCCGACGGUGAUAGUCCGGAUGGGAGAAAGGAAGC
RS 2 dot ………(((..(((((…….))))).)))((((….(((((((…….)))))))….))))…((((((((…))))))))(((.(((((…….))))).))).(((…….)))……………..
RS 3 seq AAUUAGUUUCAGGGGUGGUGAAAGUCCACACCGGAGGUGAGCAGCAGUUUCUGUUAUGCUGUAAGUCCUCGAACGCCUCGCCAGUGUGCCCGGCGCCGAACGGGUGAGAAACCCGUACCGACGGUAUAGUCCGGAUGAAAGAAACGACAU
RS 3 dot …………((((((…….)))).)).(((((..((((((……….))))))..).))))…((((..((……))..))))….((((((…..)))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table