Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021287 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA021287
Gene: CFH
MFE: -1.249
ENS: 0.653
Length: 52.
Predicted Ligands:
glutamine - 17/20
unknown - 2/20
fluoride - 1/20
 RS: URS0000C57FE6_12908
MFE: -6.747
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C28F75_12908
MFE: -5.838
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C49C25_12908
MFE: -13.116
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021287 URS0000C57FE6_12908 URS0000C28F75_12908 URS0000C49C25_12908
Length 52. 53. 52. 52.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.653 - - -
MFE -1.249 -6.747 -5.838 -13.116
Ligands - glutamine glutamine glutamine
Gene CFH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.079 1. 2.001
Length SE - 1. 0. 0.
Lev Distance - 15. 17. 18.
UBS 2. 2. 2. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 1. 0. 1. 2.
H 1. 2. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.135 0.415 0.115 0.173

Sequences

Field Description
UTR seq + 25 uuuggcaaugauuaauuauauauucucATGAGACTTCTAGCAAAGATTATTT
UTR dot + 25 ……(((((((……….(((….)))………..))))))).
RS 1 seq AUCGUUCAACUUCUUAGGAAGUCGGAAGUAGGUAUAAACCGAAGGAACGCGCC
RS 1 dot ……..((((((………)))))).(((….)))………….
RS 2 seq AUCGUUCAUCUAUUAUAGACGGAAGUAGGUUACUCAACCGAAGGAACGCACC
RS 2 dot ..((((((((((((………)))))))………….)))))….
RS 3 seq UACGUUCAUCCCUCCGGGGACGCAAGUAGGACAGAGUCCGAAGGAACGGGAG
RS 3 dot ……..(((((((..((((…………..))))…)))..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table