Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021321 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA021321
Gene: CFHR3
MFE: -14.925
ENS: 0.974
Length: 112.
Predicted Ligands:
guanidine - 16/20
TPP - 2/20
glycine - 1/20
 RS: URS0000D89707_1121306
MFE: -20.966
Ligand: glycine
Species: Clostridium collagenovorans DSM 3089 Glycine riboswitch
 RS: URS0000C7AFBA_1223565
MFE: -49.804
Ligand: guanidine
Species: Rhizobium sp. Pop5 Guanidine-I riboswitch
 RS: URS0000127534_1211777
MFE: -46.704
Ligand: guanidine
Species: Rhizobium mesoamericanum STM3625 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021321 URS0000D89707_1121306 URS0000C7AFBA_1223565 URS0000127534_1211777
Length 112. 112. 112. 112.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.974 - - -
MFE -14.925 -20.966 -49.804 -46.704
Ligands - glycine guanidine guanidine
Gene CFHR3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 8. 8.
Length SE - 0. 0. 0.
Lev Distance - 33. 35. 35.
UBS 5. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 3. 1. 1.
H 2. 1. 3. 3.
BL 3. 2. 2. 2.
BR 0. 1. 1. 1.
UN 0.161 0.125 0.170 0.170

Sequences

Field Description
UTR seq + 25 acacuugguaacuaauaaugaaagauuucaaaccccaaacagugcaacugaaacuuuuguauuagcauacuacugagaauaucuaacATGTTGTTACTAATCAATGTCATTC
UTR dot + 25 …(((((((.(((((.(((((((.(((((………………)))))))))))))))))…..)))))))……….((((((……..))))))…..
RS 1 seq AGACACAUCCCUGGAGAGAUUCAUUUAACUAUGAACAUCGACGGAGAAACUUAAGGUGUAAGUGGUAUUACAUAUUAAGGAAACUUUCAGAUAAAAGGACAGGGAAUAGAUA
RS 1 dot …….(((((((((((.(((.(((((((((..(((((……………)))))..)))))………))))))).)))))………..))))))…….
RS 2 seq UGAGUUGGUGGCUAGGGUUCCGGCGCUUUUCUGAAGUGCGGCUGGUCCGAGAGCCACCACCGGUGGGGGAGAAAUCCCGCCGGGUGCACGGCGGGACAAAAGCCCGGGAGAC
RS 2 dot …..((((((((.(((..(((((((………..))).)))))))…))))))))(((((((((……)))))))))……..((((.(….)))))……
RS 3 seq UGAGUUGGUGGCUAGGGUUCCGGCGCUUUCCUGAAGUGCGACUGGUCCGAGAGCUACCACCGGCCGGGGAGAAAUCCGGUCGGGUGCACGGCGGGACAAAAGCCCGGGAGAC
RS 3 dot …..((((((((.(((..(((((((………..))).)))))))…))))))))(((((((((……)))))))))……..((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table