Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021322 Similarity: 0.971 Similarity: 0.971 Similarity: 0.970
UTR: 5HSAA021322
Gene: CFHR3_0
MFE: -14.925
ENS: 0.976
Length: 117.
Predicted Ligands:
TPP - 5/20
molybdenum - 5/20
guanidine - 4/20
 RS: URS0000C5B84E_1094508
MFE: -34.664
Ligand: TPP
Species: Thermoanaerobacterium saccharolyticum JW/SL-YS485 TPP riboswitch (THI element)
 RS: URS0000AB950D_177437
MFE: -31.054
Ligand: TPP
Species: Desulfobacterium autotrophicum HRM2 TPP riboswitch (THI element)
 RS: URS0000AB85E0_469371
MFE: -42.821
Ligand: TPP
Species: Thermobispora bispora DSM 43833 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021322 URS0000C5B84E_1094508 URS0000AB950D_177437 URS0000AB85E0_469371
Length 117. 117. 118. 117.
Similarity - 0.971 0.971 0.970
Ensemble Norm 0.976 - - -
MFE -14.925 -34.664 -31.054 -42.821
Ligands - TPP TPP TPP
Gene CFHR3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.004 23.004 32.007
Length SE - 0. 1. 0.
Lev Distance - 35. 31. 30.
UBS 5. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 3. 2.
ILR 1. 3. 3. 3.
H 2. 2. 2. 2.
BL 3. 3. 3. 5.
BR 0. 2. 1. 2.
UN 0.197 0.137 0.136 0.111

Sequences

Field Description
UTR seq + 25 gaaccacacuugguaacuaauaaugaaagauuucaaaccccaaacagugcaacugaaacuuuuguauuagcauacuacugagaauaucuaacATGTTGTTACTAATCAATGTCATTC
UTR dot + 25 ……..(((((((.(((((.(((((((.(((((………………)))))))))))))))))…..)))))))……….((((((……..))))))…..
RS 1 seq UAUUUUUGUCUGGGGAGCUGGGGUGAUAGCCCGGCUGAGAGUUAGCAGCUAUUUCUGCUAUGACCCAUAAACCUGAUCUGGAUAAUGCCGGUGUAGGGAGUACAUUGGACUUUAAGU
RS 1 dot …..(((((((((.((.((((((.(((((..(((((……..)))))……))))).)))).))…))..)))))))))..((((((((…..))))))))………
RS 2 seq AUGGAAGGCUGGGGGAGUCGAAGGUAUUCGGCUGAGAGGAAACAAAAAGCAACCCUUGUUUCGACCCCUGGAACCUGAUCCGGCUCAUAUCGGCGAAGGAAAGCCCCUUUCCCCCAUC
RS 2 dot …….(((((..((((((.((((.(((((..(.(..(((((((……….)))))))..)).)))))))))….))))))…)))))…((((((…))))))……
RS 3 seq CGAUCGAACCGCGGGAGCUCGGGCCUGACCGGGCUGAGAGGGCGGCUGACACGGCGCCGCCGACCGCCUGAACCUGUCCGGGUAAUACCGGCGUAGGGAGUGUGCGAUGACGUCUGG
RS 3 dot ………(((.((.((((((((…..(((((.(.(..((((((………))))))..)))))))…..))))))))….)).)))..(((.((……..)).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table