Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021325 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA021325
Gene: CFHR4
MFE: -9.766
ENS: 0.855
Length: 94.
Predicted Ligands:
glycine - 9/20
zmp-ztp - 3/20
TPP - 3/20
 RS: URS0000C09427_12908
MFE: -27.260
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS0000D6C073_12908
MFE: -25.960
Ligand: zmp-ztp
Species: unclassified sequences ZMP/ZTP riboswitch
 RS: URS0000D9DC94_1897022
MFE: -26.775
Ligand: zmp-ztp
Species: Subdoligranulum sp. 60_17 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021325 URS0000C09427_12908 URS0000D6C073_12908 URS0000D9DC94_1897022
Length 94. 94. 94. 94.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.855 - - -
MFE -9.766 -27.260 -25.960 -26.775
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene CFHR4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 6. 2.
Length SE - 0. 0. 0.
Lev Distance - 22. 22. 24.
UBS 4. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 0. 0. 1. 0.
UN 0.128 0.138 0.138 0.138

Sequences

Field Description
UTR seq + 25 ugaaagauuucaaaccccaaacagugcaacugaaacuuuugcauuacuauacuacugagaauaucuaacATGTTGTTACTAATCAATGTCATTC
UTR dot + 25 ….((((((((……….(((((((………)))))))……….)))))…)))…((((((……..))))))…..
RS 1 seq CGCAAGGCCGCUGACCGACGGGAUAUUGUGGGGCUUACCACAGGGGACGCGGCGUUAUCACUUGCCUUUUAAGCCGACCGUCUGGGCUGCAUAC
RS 1 dot .((((((((((…((………((((((……))))))))…)))))…….)))))……((((………))))……
RS 2 seq CGCAAGGCCGCUGACCGACGGGAUAUGUGGGGGCUUACCACAGGGGACGCGGCGUUAUCACUUGCCUUUUAAGCCGACCGUCUGGGCUGCAUAC
RS 2 dot .(((((((((((..((………(((((…….)))))))..).)))))…….)))))……((((………))))……
RS 3 seq UGCAAGGCCGCCGACCGACGGAAUAGCGUGGGGUUUACCACGGGGGACGCGGCAUAACAGCUUGCUUUUUAAGCCGACCGUCUGGGCUGCAUAC
RS 3 dot .((((((((((…((……….(((((……)))))))….)))))…….)))))……((((………))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table