Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021326 Similarity: 0.957 Similarity: 0.957 Similarity: 0.954
UTR: 5HSAA021326
Gene: CFHR4_0
MFE: -29.157
ENS: 0.894
Length: 162.
Predicted Ligands:
cobalamin - 11/20
Mg2+ - 6/20
TPP - 1/20
 RS: URS00023254C3_1240678
MFE: -67.113
Ligand: cobalamin
Species: Streptomyces natalensis ATCC 27448 Cobalamin riboswitch
 RS: URS0000D8905F_1897011
MFE: -45.726
Ligand: Mg2+
Species: Oscillibacter sp. 57_20 M-box riboswitch (ykoK leader)
 RS: URS0000AB6C02_1226323
MFE: -47.632
Ligand: Mg2+
Species: Oscillibacter sp. KLE 1745 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021326 URS00023254C3_1240678 URS0000D8905F_1897011 URS0000AB6C02_1226323
Length 162. 162. 163. 163.
Similarity - 0.957 0.957 0.954
Ensemble Norm 0.894 - - -
MFE -29.157 -67.113 -45.726 -47.632
Ligands - cobalamin Mg2+ Mg2+
Gene CFHR4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19.001 16. 18.
Length SE - 0. 1. 1.
Lev Distance - 48. 49. 52.
UBS 11. 13. 13. 14.
BS 0. 0. 0. 0.
ILL 2. 5. 5. 4.
ILR 5. 4. 6. 6.
H 2. 2. 2. 2.
BL 5. 4. 4. 5.
BR 2. 4. 3. 4.
UN 0.043 0.068 0.061 0.043

Sequences

Field Description
UTR seq + 25 aagugaccuuaaagcccuagcuuugugguagugcacuuaaauucagaaucacacuugguaacuaauaaugaaagauuucaaaccccaaacagugcaacugaaacuuuugcauuacuauacuacugagaauaucuaacATGTTGTTACTAATCAATGTCATTC
UTR dot + 25 ((((((((.((((((….)))))).)))….)))))…….((((.(((.((((((((.(((.(((..((((((((……….(((((((………)))))))……….)))))…)))..))))))))))))))….))).))))
RS 1 seq GCUCGCCGGUCGGUUCGCGGUAGCGUCCCGAUGAUAUUGACGAUGACAUGACGGAAGCCGGUGGGAUCCCGGCGCGGUCGCGCCACUGUAUGUCCGGUUUUGACUCAGCCCCACAGGGGCCGGGACCGGGCAAGCCAGACCCGCCAUGUCGUCCGGCGCUCC
RS 1 dot ..(((.(((((((..(((….)))..)))))…..)).)))………(((.((((((((.((…((((.((((..((…….((((((((((((…..(((((…))))))))))))))))).))..)))))))))).))).)))))..)))
RS 2 seq AUAGAGUUCCGGUAGGUAAGGCUACCACAGGGAUAUGGAUCGCUGCCGCGGAGUGAUGGAGACAUCAUGAGAGGGUUUGAACAGGCGAUAUCGAACAACAAGGUAUCAUCUAACGCGAUUUCACCGCCCUGUGAAGCUAAAGCUUGAACGGUAGGGAUGCUGU
RS 2 dot …..((((((((((……)))))…)))))..(.(((.((((((..((((..(((…(.((((…(((((.((((…((((((((………))))))…….))…))))..))))))))).))))..))))…)))))).))).)…
RS 3 seq CAUACCGUCCGGUAGGUAAGGCUACCACAGGGAUACGGAUCGCUGCCGCGGAGUGAUGGAGACAUCAUGAGAGGGUUUGAACAGGUGCUAUCGAACACGAAGGUAUCAUCUAAUGUGAUUUCACCGCCUUGUGAGGCUAAAGCUUGAACGGCCGCAGGGUCCG
RS 3 dot ……(((((((((……)))))….)))).((((((.((((.((.((((..(((…(.(((((((..(((….(((((((((.(((….))).))))))……)))……)))..)))))))).)))..)))….).)).))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table