Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021327 Similarity: 0.982 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA021327
Gene: CFHR4_1
MFE: -9.766
ENS: 0.830
Length: 91.
Predicted Ligands:
glycine - 9/20
SAM - 4/20
zmp-ztp - 4/20
 RS: URS0000AB3B00_272621
MFE: -17.552
Ligand: SAM
Species: Lactobacillus acidophilus NCFM SMK box translational riboswitch (SAM-III)
 RS: URS0000C0CC96_1265861
MFE: -16.231
Ligand: glycine
Species: Brochothrix campestris FSL F6-1037 Glycine riboswitch
 RS: URS0000C7F8F9_1423726
MFE: -16.903
Ligand: TPP
Species: Lactobacillus bifermentans DSM 20003 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021327 URS0000AB3B00_272621 URS0000C0CC96_1265861 URS0000C7F8F9_1423726
Length 91. 91. 91. 91.
Similarity - 0.982 0.980 0.980
Ensemble Norm 0.830 - - -
MFE -9.766 -17.552 -16.231 -16.903
Ligands - SAM glycine TPP
Gene CFHR4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 3. 3.058
Length SE - 0. 0. 0.
Lev Distance - 24. 26. 26.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 2. 2. 2. 1.
H 2. 2. 1. 3.
BL 0. 1. 1. 0.
BR 0. 0. 1. 0.
UN 0.099 0.088 0.110 0.341

Sequences

Field Description
UTR seq + 25 aagauuucaaaccccaaacagugcaacugaaacuuuugcauuacuauacuacugagaauaucuaacATGTTGTTACTAATCAATGTCATTC
UTR dot + 25 .((((((((……….(((((((………)))))))……….)))))…)))…((((((……..))))))…..
RS 1 seq UAUCGGUUCAAGUCCUGAAAGGAUUCAUUAAAUAAUUAGUGAAGAUGCCUUGUAACCGAAUAGCCGAUGUCUAUAUAGGGGGACUAAUAUG
RS 1 dot .(((((((……….((((.((((((((….))))))))….))))……….)))))))((((……..))))…….
RS 2 seq CUGAACAUAGUGAGAGAGCAUGCAAAAAGCAUCACCGAAGGGGCAAGUGUUGCGACACGAAACUCUCAGGUAAACGGAUUACUAUGGGACA
RS 2 dot …..(((((((((((((……….(((.(((………..))).)))………)))))………..))))))))…..
RS 3 seq UUAACGUAUCUGGGGUGCCGCAAUGGCUGAGAUCAUACCCACCGAACCUGCUCUGGUUAAAACCUGCGAAGGAAGAUACAGUCCUUAAUGA
RS 3 dot …………(((((((…..)))………))))….((((……))))……….(((((……..)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table