Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021777 Similarity: 0.986 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA021777
Gene: CHKA
MFE: -22.253
ENS: 0.747
Length: 60.
Predicted Ligands:
fluoride - 8/20
unknown - 5/20
cobalamin - 4/20
 RS: URS0000C22AF4_1734399
MFE: -14.943
Ligand: molybdenum
Species: Clostridia bacterium BRH_c25 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D7DB18_1895812
MFE: -18.195
Ligand: fluoride
Species: Rhizobiales bacterium 63-22 Fluoride riboswitch
 RS: URS0000BE809B_526988
MFE: -12.775
Ligand: fluoride
Species: Bacillus cereus Rock4-18 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021777 URS0000C22AF4_1734399 URS0000D7DB18_1895812 URS0000BE809B_526988
Length 60. 61. 61. 60.
Similarity - 0.986 0.985 0.985
Ensemble Norm 0.747 - - -
MFE -22.253 -14.943 -18.195 -12.775
Ligands - molybdenum fluoride fluoride
Gene CHKA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.027 5.010 3.018
Length SE - 1. 1. 0.
Lev Distance - 16. 17. 19.
UBS 5. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 2. 1. 1. 1.
BR 1. 1. 0. 1.
UN 0. 0.164 0.098 0.133

Sequences

Field Description
UTR seq + 25 gcggccgcccgcgccuccucggccgccugucgggcATGAAAACCAAATTCTGCACCGGGG
UTR dot + 25 (((((((…………)))))))((.(((((((.(((…….)))))).))))))
RS 1 seq AGGGUUUAGGAAGAAAUCCCUGAGCCUCCCGUGUUAGGAAAGGAAAAUGUUUUGUUAAAUG
RS 1 dot .(((((((((……..)))))))))……((((.((((…….)))).))))…
RS 2 seq CCAGUCGUAGGGGAUGGAGUUCCCCCUGAACCGCCGUAAGGCUGAUGACUCCUGAACGGUC
RS 2 dot .(((…..(((((……))))))))….(((((.(((………)))..))))).
RS 3 seq AUAAUUAUAGGCGAUGGAGUUCGCCAUAACCGCUGCUUAGCUAAUGACUCCUAUCAGUAU
RS 3 dot ….((((.(((((……)))))))))..((((..(((……….))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table