Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA021938 Similarity: 0.982 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA021938
Gene: CHRFAM7A
MFE: -20.865
ENS: 0.915
Length: 104.
Predicted Ligands:
TPP - 15/20
purine - 3/20
SAM - 2/20
 RS: URS00023323F0_1797787
MFE: -20.321
Ligand: SAM
Species: Candidatus Daviesbacteria bacterium RIFCSPLOWO2_01_FULL_40_24 SAM riboswitch (S box leader)
 RS: URS0000C4D6EA_157733
MFE: -15.090
Ligand: purine
Species: Bacillus macyae Purine riboswitch
 RS: URS0000DB5DA6_1798803
MFE: -18.718
Ligand: TPP
Species: Alkalibacterium sp. 20 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA021938 URS00023323F0_1797787 URS0000C4D6EA_157733 URS0000DB5DA6_1798803
Length 104. 104. 103. 104.
Similarity - 0.982 0.981 0.980
Ensemble Norm 0.915 - - -
MFE -20.865 -20.321 -15.090 -18.718
Ligands - SAM purine TPP
Gene CHRFAM7A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 11. 3.
Length SE - 0. 1. 0.
Lev Distance - 23. 20. 26.
UBS 8. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 3. 2. 2. 2.
H 2. 2. 2. 2.
BL 1. 2. 3. 2.
BR 2. 2. 3. 3.
UN 0.173 0.154 0.175 0.183

Sequences

Field Description
UTR seq + 25 cuaugggaacuugaggagucaugguucacaauguacuucuaaaccacuauaaugaaacaaccaccaucgguuaaauuugATGCAGGAGGCAGATATCAGTGGCT
UTR dot + 25 ………….(((((((((……..))).))))))…((((((((.((…(..((..((((((……))))))..))..)))..))).)))))..
RS 1 seq AGUUAAUCUAGAGUGAUGGGGAGAGAAUUGGCUCAAUGAUCCAUCCAGCAUCCGAUCCAAAAGACACGGUGCUACACCCAACCUUGUAAGAGGAAGGAUUUGUU
RS 1 dot …………..(((((((((……..)))…..))))))(((.((((..(((…..(((.(((……….))).)))….))).)))))))..
RS 2 seq AUACAACUUCACAUUUAUCUCUAUAUAAUUUUGGAAAUAGGGUCCAAUAAGUUUCUACCCGGCAACCGUUAAUUGCUGGACUAUAGGGAAGGUACGCAUUGUU
RS 2 dot ………….(((((.((((……..)))).)))))…((((..((.(((.((((((((…….)))))……..))).))).))..))))..
RS 3 seq ACGAAUGAUCCUGGGAGUCUUUUCAAGAAGGCUGAGAGUGAUGUAUAUCAGACCAGUAACCUGAUCAGCGUAAUGGCUGCGGAGGGAGAUCUAUAUAUGAUGGC
RS 3 dot ……………(((((((….)))))))….((.((((((((.(((….(..(((…((((……))))…)))..).))))))))).)).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table