Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022072 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA022072
Gene: CHURC1
MFE: -28.420
ENS: 0.954
Length: 99.
Predicted Ligands:
TPP - 14/20
homocysteine - 2/20
purine - 2/20
 RS: URS0000AB43C6_768706
MFE: -20.721
Ligand: TPP
Species: Desulfosporosinus orientis DSM 765 TPP riboswitch (THI element)
 RS: URS0000ABABED_768704
MFE: -20.329
Ligand: TPP
Species: Desulfosporosinus meridiei DSM 13257 TPP riboswitch (THI element)
 RS: URS0000D9F748_1842727
MFE: -32.151
Ligand: homocysteine
Species: Rhodoferax koreense S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022072 URS0000AB43C6_768706 URS0000ABABED_768704 URS0000D9F748_1842727
Length 99. 99. 99. 99.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.954 - - -
MFE -28.420 -20.721 -20.329 -32.151
Ligands - TPP TPP homocysteine
Gene CHURC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.008 2. 10.001
Length SE - 0. 0. 0.
Lev Distance - 27. 28. 25.
UBS 8. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 3. 3. 3. 1.
H 2. 2. 2. 2.
BL 2. 2. 2. 4.
BR 2. 2. 3. 3.
UN 0.131 0.222 0.131 0.162

Sequences

Field Description
UTR seq + 25 aaccguaucucaguucucgcgagguuucgucuucccggaagcguuggaggacauucccuguugacugcgucgcgATGCGGCAACCGTATCTCAGTTCTC
UTR dot + 25 ….((..(.(((((…((.(((….(((((((((….))..)))))))….))))).))))).)..))(((((((…)))))))………
RS 1 seq AAUAUUUUGCGGGGGGACUCUUAGGAGUUGAGAAGGUAGAACCUGACCCUUAGAACCUGUCAGUUAACACUGGCGUAGGGAAGCAAUCCAUUAUCAAUG
RS 1 dot ……..((.(((.((((..((((..(((((..(((……..))))))))..))))..))))..).)).))….(((…..)))……….
RS 2 seq AUAAUUUUGCGGGGGGACUCUUAGGAGUUGAGAAGGUAGAACCUGACCCUUAGAACCUGUCAGUUAACACUGGCGUAGGGAAGCAAGCCACUAUCAAUU
RS 2 dot ……..((.(((.((((..((((..(((((..(((……..))))))))..))))..))))..).)).))((((((…….)).))))…..
RS 3 seq GAUUCCGAGGAGCGCUGCAGCCCCUGGCCCGUUGAGACAUCGGGUCACGGUGUGAGGCUCGGAAAACCGUCCAUCAAGUGAUAACGGCGCUCACCCACU
RS 3 dot ..((((…((((.((.((..((.(((((((.((…)).))))))).))..))))))))))))..((((..(((….))).))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table