Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022073 Similarity: 0.955 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA022073
Gene: CHURC1_0
MFE: -55.962
ENS: 0.974
Length: 160.
Predicted Ligands:
Mg2+ - 6/20
cobalamin - 6/20
glucosamine - 3/20
 RS: URS0000C3BA14_1318466
MFE: -31.954
Ligand: Mg2+
Species: Acholeplasma palmae J233 M-box riboswitch (ykoK leader)
 RS: URS0000AB5B3C_596318
MFE: -34.863
Ligand: Mn2+
Species: Acinetobacter radioresistens SK82 yybP-ykoY manganese riboswitch
 RS: URS0000D87000_1897030
MFE: -51.955
Ligand: Mg2+
Species: Firmicutes bacterium CAG:176_59_8 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022073 URS0000C3BA14_1318466 URS0000AB5B3C_596318 URS0000D87000_1897030
Length 160. 161. 158. 160.
Similarity - 0.955 0.953 0.953
Ensemble Norm 0.974 - - -
MFE -55.962 -31.954 -34.863 -51.955
Ligands - Mg2+ Mn2+ Mg2+
Gene CHURC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 8.009 22.004
Length SE - 1. 4. 0.
Lev Distance - 57. 54. 54.
UBS 10. 11. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 4.
ILR 1. 2. 2. 3.
H 4. 5. 3. 3.
BL 4. 4. 3. 2.
BR 3. 4. 4. 3.
UN 0.106 0.087 0.013 0.044

Sequences

Field Description
UTR seq + 25 agacuucggcucgguucccgagacggaauacccaggagucgaguacuugggcgcaugcggcaaccguaucucaguucucgcgagguuucgucuucccggaagcguuggaggacauucccuguugacugcgucgcgATGCGGCAACCGTATCTCAGTTCTC
UTR dot + 25 ….((((.(((((…))))).))))…((((((………))))))((.((((((((((………((((((.(((.(((((………))))).)))))))))…….)))).)))))))).(((((((…)))))))………
RS 1 seq AAUCAUUGCUGGUAGGUGAGGCUACUUUAAGGAUACGGAUUACUGCCGUCACUUUGUGGAGACAAAAAGUGUUUGGUUUGAAAAGUCUAAAUCGGAUCAAGGUUUAGAAUAAUGUAAUUUCAUUGCCUUAUUGAGCUAAAACUUAAACAUUGGCUUUUUAA
RS 1 dot .(((.(((..(((((……))))).))).)))((((…….))))((((((.((….)).))))))…(((.((((((.((((((((…….)))))))).)…….)))))..)))…..(((((((……….)))))))…..
RS 2 seq GCCUACUUCAUUGGGGAGUAGCCGCUAUUUACGUUCCAGUAAAUAGGUGAUGGUCAACAUAAUUGUUCAACAGAACAUGGUCAUCAUAGCCAAAGAACCCGAGCUUUAAUUCUUUUGUUGGCAAGACCUUUGAUUUAUCUUUCUGCUUGAUUAUGGCU
RS 2 dot (.(((((((…..))))))).).((((((((……))))))))((.((((((((((………..((((….((((….((((.((((((…………)))))).))))….))))))))………..)).)))))))).)).
RS 3 seq AACUCUAUCCGGUAGGUAAGGCUACCGCGAGGGAUAUGGGCUGCUGCCGCGAAGUGGUGGAGACACCAUGAGAUGGUUUGAGCAGGUACUAUCGAAACCAAGGUGGUAUCUAACGCAGCUUCACUGCCCCGCGAUGCUAAAGCUCGUAACGGUAAUCCAG
RS 3 dot …(((.((((((((……)))))).)).)))((((((((…((((((..(((((((((.(………(((((…..((((((((((……..))))))))))))).))))))))))))..))))..))…))))))))..((….))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table