Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022350 Similarity: 0.961 Similarity: 0.959 Similarity: 0.958
UTR: 5HSAA022350
Gene: CLCA1
MFE: -28.340
ENS: 0.923
Length: 154.
Predicted Ligands:
Mg2+ - 5/20
FMN - 3/20
cobalamin - 3/20
 RS: URS0000AB5859_1262853
MFE: -39.007
Ligand: Mg2+
Species: Coprobacillus sp. CAG:183 M-box riboswitch (ykoK leader)
 RS: URS0000C272F7_1385514
MFE: -49.281
Ligand: FMN
Species: Pontibacillus yanchengensis Y32 FMN riboswitch (RFN element)
 RS: URS00023280A6_698760
MFE: -67.245
Ligand: cobalamin
Species: Streptomyces turgidiscabies Car8 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022350 URS0000AB5859_1262853 URS0000C272F7_1385514 URS00023280A6_698760
Length 154. 155. 153. 154.
Similarity - 0.961 0.959 0.958
Ensemble Norm 0.923 - - -
MFE -28.340 -39.007 -49.281 -67.245
Ligands - Mg2+ FMN cobalamin
Gene CLCA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.005 8.002 7.019
Length SE - 1. 1. 0.
Lev Distance - 47. 50. 53.
UBS 10. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 3. 5. 3. 4.
ILR 4. 3. 2. 4.
H 4. 4. 5. 3.
BL 2. 1. 1. 3.
BR 1. 3. 2. 1.
UN 0.149 0.077 0.105 0.013

Sequences

Field Description
UTR seq + 25 gauaaaccacuuccgauaaguuggaaacgugugucuauauuuucauaucuguauauauauaaugguaaagaaagacaccuucguaacccgcauuuuccaaagagagaaaucacagggagauguacagcaATGGGGCCATTTAAGAGTTCTGTGT
UTR dot + 25 ……….((((((….))))))(((.((((((…..(((.((((..(((….)))..))))..)))))))))…)))…..(((((((((…((……))…)))))))))……((((((((……).)))))))..
RS 1 seq UAAAAGAAUCGGUAGGUGAGACUACCAUAGGGAUACGGGUUGCUACCGCAAAGCAGUGGAGACACUGUGCGCUGGUCAACAGUUCUUGUCGUGAAGGCAAAAACUAAUGCAAUUACAUGGCCCUAUGAUGUUGAAGCUUGAACGAGAUAAAGUUA
RS 1 dot ……….(((((……)))))((((((((….(((((((.(((…((((((….))))))))).))).)))).)))))))).((((..(((……..)))..)))).((((..(((..((((……..))))..)))..))))
RS 2 seq UUCCAUCUUCGGGGCAGGGUGAAAUUCCCGACCGACGGUGAAGAACCCACUUGGUGUUCUAAGUCCGUGACCCGGGAGGCCAUUUUUGGCCAAGCGGUGGACCUGGUGAGAAUCCGGGACCGACAGUUACAGUCUGGAUGGGAGAAGAUGUAG
RS 2 dot …((((((……))))))….(((((….(((((..(((((((….)).)))))..).))))….)))))(((((….)))))…((((…(((((…….)))))))))…..((((.(((……….))))))).
RS 3 seq GCCGAACUCCCGCUUCGCGGUACCUUCUCGUCGAUAUUGACGACGGUUCGACGGAAGCCGGUGGGAAUCCGGCACGGUCGCGCCACUGUAAGCCCCGUACGCACCAGCCUGGUGUGGCCCGGGGGCAAGUCAGACCCGUGACUGUCGUCCUCCG
RS 3 dot ((((…((((((….(((…((((.((((((.((((….)))))))))))))))))))))))…))))..(((((((((((((…((…….))..)))..))))))))))(((((((.(((((……)))))…)))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table