Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022358 Similarity: 0.988 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA022358
Gene: CLCA4
MFE: -11.549
ENS: 0.976
Length: 69.
Predicted Ligands:
fluoride - 14/20
glycine - 1/20
cobalamin - 1/20
 RS: URS00023242EC_1731
MFE: -17.237
Ligand: glycine
Species: Eubacterium acidaminophilum Glycine riboswitch
 RS: URS0000D86707_1121390
MFE: -17.166
Ligand: fluoride
Species: Desulfacinum hydrothermale DSM 13146 Fluoride riboswitch
 RS: URS0000D88FD6_1817879
MFE: -13.231
Ligand: fluoride
Species: Candidatus Schekmanbacteria bacterium RBG_16_38_10 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022358 URS00023242EC_1731 URS0000D86707_1121390 URS0000D88FD6_1817879
Length 69. 70. 69. 69.
Similarity - 0.988 0.988 0.987
Ensemble Norm 0.976 - - -
MFE -11.549 -17.237 -17.166 -13.231
Ligands - glycine fluoride fluoride
Gene CLCA4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.008 3.001 2.001
Length SE - 1. 0. 0.
Lev Distance - 14. 16. 17.
UBS 3. 4. 4. 3.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 1. 1. 2. 1.
H 1. 1. 1. 1.
BL 0. 1. 1. 1.
BR 0. 0. 0. 0.
UN 0.174 0.086 0.145 0.203

Sequences

Field Description
UTR seq + 25 uugaacaaaccaacauuugagccaggaauaacuagagaggaacaATGGGGTTATTCAGAGGTTTTGTTT
UTR dot + 25 ………..((((…(((((..((((((((……………))))))))…))))))))).
RS 1 seq AUGAAGGUGGCAGGAGAGACCCAUGAGGGGCGCCGAAGAAGUAAAGCUUUCAGGCUUAGGACUGUCAUCA
RS 1 dot …..((((((((..(((.((..((((((……………..)))))))))))….)))))))).
RS 2 seq AUUGGGAAAGGCAAAGAAGUCUGCCUGAACCACCUGCCCAACGUGCAGGUUGAUGACUUCUACCCCUGC
RS 2 dot ……..(((…(((((((.(((((…(((………))))))))….)))))))…)))..
RS 3 seq AUUAGAAACGGCGAUGGAGUUUGCCUAUAACUGCUUACAAAAAUUGAGGCUGAUAACUCCUGCUAAAGG
RS 3 dot ………((((..((((((.((((………………..))))….))))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table