Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022359 Similarity: 0.969 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA022359
Gene: CLCA4_0
MFE: -23.883
ENS: 0.932
Length: 130.
Predicted Ligands:
FMN - 7/20
TPP - 6/20
cobalamin - 2/20
 RS: URS0002331B4F_1460639
MFE: -32.072
Ligand: cobalamin
Species: Bacillus sp. JCM 19045 Cobalamin riboswitch
 RS: URS000016D25A_62977
MFE: -39.481
Ligand: TPP
Species: Acinetobacter sp. ADP1 TPP riboswitch (THI element)
 RS: URS0000D7E77F_1903686
MFE: -32.522
Ligand: FMN
Species: Jeotgalibaca sp. PTS2502 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022359 URS0002331B4F_1460639 URS000016D25A_62977 URS0000D7E77F_1903686
Length 130. 131. 130. 129.
Similarity - 0.969 0.967 0.966
Ensemble Norm 0.932 - - -
MFE -23.883 -32.072 -39.481 -32.522
Ligands - cobalamin TPP FMN
Gene CLCA4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.026 7.046 5.008
Length SE - 1. 0. 1.
Lev Distance - 40. 42. 42.
UBS 9. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 2. 2. 2. 3.
H 3. 3. 4. 3.
BL 2. 1. 0. 3.
BR 2. 2. 1. 1.
UN 0.262 0.099 0.046 0.171

Sequences

Field Description
UTR seq + 25 uaaucagccaauacugguaaguuuuaggaacguauauaaagagaaagaaaagaaaagccucuugaacaaaccaacauuugagccaggaauaacuagagaggaacaATGGGGTTATTCAGAGGTTTTGTTT
UTR dot + 25 ……((((….))))..((((…))))………………….((((((((.((((..((((..((.(((..((((……))…..))..))))).)))).))))))))))))….
RS 1 seq UUUCAUAACCAACACUCAGGUGUAGCAUUUGCUACGAAAAGGGGAACUUGGUGCAAAUCCAAGGCGGUCCCGCCACUGUGACGUAAUACUAUUUACGGAGUCAGAUUACCUGCCUGAUUGUUCUGCUUAGC
RS 1 dot …….(((……..)))(((((….)))))…(((.(((((……..((((..((((((……..((((..(((((……)))))..).)))…..))))))))))))))).)))…
RS 2 seq GCAUGCUUGACGGAGCGCGAGUAACAACUCGCUGAGAUUGGGUAAAUCUGUUUUUUGAACUGAUUUGAUCCCAAGUACCGUUGAACCUGAUCAGGUUAAUACCUGCGUAGGAAUCAAGUCAUCAAAAAAC
RS 2 dot ….((((….))))((((((….))))))..(((((…..)))))(((((((((..(((((((((((…(((……(((((….)))))……)))…))).)))))))))))))))))
RS 3 seq AAACGUCUUCAGGGCAGGGUGAAAUUCCCGACCGGUGGUUAGAGUCCACGAGCUUUUAUCCGUUUUGAUAAAAGUUGAACUGGUGAAAUUCCAGUACCGACAGUAUAGUCUGGAUGGAAGAAGAUAAUG
RS 3 dot …………((..(((…….)))..)).((((…….))))…(((((.(((((((.(((….((((.(((((…….)))))..))))……))).))))))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table