Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022420 Similarity: 0.966 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA022420
Gene: CLCN7
MFE: -57.728
ENS: 0.905
Length: 135.
Predicted Ligands:
cobalamin - 9/20
FMN - 4/20
glycine - 2/20
 RS: URS0000AB4794_626523
MFE: -43.757
Ligand: FMN
Species: Shuttleworthia satelles DSM 14600 FMN riboswitch (RFN element)
 RS: URS0000BEBD3A_195253
MFE: -34.551
Ligand: glutamine
Species: Synechococcus sp. PCC 6312 Glutamine riboswitch
 RS: URS0000D843E4_1805090
MFE: -46.612
Ligand: glycine
Species: Comamonadaceae bacterium CG2_30_59_20 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022420 URS0000AB4794_626523 URS0000BEBD3A_195253 URS0000D843E4_1805090
Length 135. 134. 136. 134.
Similarity - 0.966 0.966 0.965
Ensemble Norm 0.905 - - -
MFE -57.728 -43.757 -34.551 -46.612
Ligands - FMN glutamine glycine
Gene CLCN7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 1.003 5.001
Length SE - 1. 1. 1.
Lev Distance - 40. 44. 43.
UBS 10. 12. 10. 9.
BS 0. 0. 0. 0.
ILL 3. 5. 3. 2.
ILR 4. 4. 5. 4.
H 2. 2. 2. 1.
BL 4. 4. 4. 3.
BR 2. 3. 2. 3.
UN 0.096 0.075 0.154 0.060

Sequences

Field Description
UTR seq + 25 gucgcucaucacguggccccgucgcgcgucacguggccgccggcgcgggucacgagaacaaacacgggggcagccggcgcuucccggccggugucgcuccgcggcgggccATGGCCAACGTCTCTAAGAAGGTGT
UTR dot + 25 ………..((((((.((((((((((.(((.((((((..(((((.(((..(…………….)..))).)))))…))))))))).)))…)))))))))))))(((..(……..)..)))..
RS 1 seq CACAAUCUUUGGGGCAGGUGAAAUUCCUGACCGGCGGUGACAGUCCGCGAACCCCUUUGGGGCCGACCCGGUGGAAUUCCGGAACCGACGGUAGCAGGCAGAUGUCUGGACAGUCCGGAUGGGAGAAGAUGGAU
RS 1 dot ……..((.(((((..((…..((((((((.((((…..((((.(((..((.(((((…..))))).))..))))))))))).))))..))))))..))))).))..(((((..(……)..)))))
RS 2 seq AUCGUUCAUCUCUUCCCAAGCUCUCCCGCUGUAAGUGCUUCAUUCACAAUCCAAACGGGUUAACGGGUGACAUUUAAGAAGCGGUCGAUAUUUGACGGUAGAGACGGAAGUAGGGAAUCCCCCGAAGGAACGCGCU
RS 2 dot ….(((.(((((.((((((.((..(((((.((((((..((((((..(((((….)))))…))))))))))))…)))))..))..))))..)).))))).)))….(((…..)))………….
RS 3 seq CGAUUCCCCACUGGAGAGAGGUCGGCCCCGGCGCUUGGCGCUAUAGCAGAUCCACCGAAGGAGCAACCCAAAACCAGCGCCUCAUGCGACUGGUGGCGGCGAAUCUCUCAGGUAAAGCGGACAGCGGGGGCAGC
RS 3 dot ….(((((.(((((((((.(((.((((((((((..((((((……..(((……)))………….))))))….))).)))).))))))…))))))…………))).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table