Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022470 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA022470
Gene: CLDN22
MFE: -12.479
ENS: 0.904
Length: 75.
Predicted Ligands:
fluoride - 12/20
guanidine - 8/20

 RS: URS000231BBF0_453247
MFE: -19.132
Ligand: fluoride
Species: Sphingomonas sp. TDK1 Fluoride riboswitch
 RS: URS0000BE355A_411462
MFE: -12.702
Ligand: fluoride
Species: Dorea longicatena DSM 13814 Fluoride riboswitch
 RS: URS0000BFB2FB_675813
MFE: -17.009
Ligand: fluoride
Species: Vibrio metschnikovii CIP 69.14 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022470 URS000231BBF0_453247 URS0000BE355A_411462 URS0000BFB2FB_675813
Length 75. 75. 76. 74.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.904 - - -
MFE -12.479 -19.132 -12.702 -17.009
Ligands - fluoride fluoride fluoride
Gene CLDN22 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.018 4.001 1.001
Length SE - 0. 1. 1.
Lev Distance - 14. 15. 16.
UBS 3. 5. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 1. 0. 0. 1.
H 2. 3. 2. 2.
BL 1. 2. 1. 0.
BR 0. 1. 1. 0.
UN 0.267 0.133 0.237 0.243

Sequences

Field Description
UTR seq + 25 agcaaccgaagggcaggaguuaguuuggcuaaagcucucaggacauuauaATGGCTTTAGTATTTAGAACTGTAG
UTR dot + 25 …..(((((.(((….)))..)))))((((((((…………….))))))))……………
RS 1 seq GCACCCCACGGCAAUGGAUUUCUGCCGGGCUUCGGCCGAACCGCCCUCGCAAGGGUCGAUGAUUCCUACUUGGCG
RS 1 dot …..((.(((((………)))))))(.((((((…………….)))))).)…((…..))..
RS 2 seq CUUUUAGAAGGGAAUGAAGUUCUCCCUUAGUGAUCAUACUAGAACCGCUUAUAAAGCUGAUGACUUCUGCGAAUAA
RS 2 dot …….((((((………))))))(((.((((……….((((…)))))))).)))………..
RS 3 seq AUGCGGCUAGGUGAUGAUGUUCCACCUAGCAGUUAUGCUAAACCGCUUUUCAAGCUGAUGACGUCUGUACAUGC
RS 3 dot …..((((((((………)))))))).((((((((………….)))..)))))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table