Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022618 Similarity: 0.983 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA022618
Gene: CLEC7A
MFE: -13.233
ENS: 0.837
Length: 96.
Predicted Ligands:
glycine - 14/20
TPP - 3/20
purine - 1/20
 RS: URS0000C1E539_1045004
MFE: -25.626
Ligand: TPP
Species: Oenococcus kitaharae DSM 17330 TPP riboswitch (THI element)
 RS: URS0000D8C62A_1411120
MFE: -22.769
Ligand: TPP
Species: Hymenobacter mucosus TPP riboswitch (THI element)
 RS: URS0000D886B8_216934
MFE: -12.117
Ligand: purine
Species: Spiroplasma corruscae Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022618 URS0000C1E539_1045004 URS0000D8C62A_1411120 URS0000D886B8_216934
Length 96. 94. 97. 96.
Similarity - 0.983 0.981 0.978
Ensemble Norm 0.837 - - -
MFE -13.233 -25.626 -22.769 -12.117
Ligands - TPP TPP purine
Gene CLEC7A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.001 7.002 9.004
Length SE - 4. 1. 0.
Lev Distance - 18. 22. 27.
UBS 5. 5. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 1.
ILR 3. 3. 3. 3.
H 1. 1. 2. 1.
BL 1. 1. 0. 1.
BR 1. 1. 1. 3.
UN 0.219 0.191 0.175 0.156

Sequences

Field Description
UTR seq + 25 auuuccugcucuugaauaucugguugaacuacuuaagcuuaauuuguuaaacuccggggcucucaagaacaATGGAATATCATCCTGATTTAGAAA
UTR dot + 25 ..((((((.((((((…(((((…(((…………….)))…..)))))….)))))).))..))))……………….
RS 1 seq UACUUCUAUCUGGGGUGCUUGCCUAUAGCAAGCUGAGAAUUACCCAUUGAACCUGUAGGUUAGUACCUGCGUAGGGAGAUAACAAAAAGAGUCG
RS 1 dot ..(((((..(..(((((((.(((((((((((……………)))…)))))))).)))))))..)..)))))…………….
RS 2 seq CGUAAACUUUAGGGGUGUCCUGCUAGCCAGGACUGAGAUGAUACCCUUUGAACCUGAUCAGGCUGAUACCUGCGAAGGGAAAAGUAGCAGAAAGCAC
RS 2 dot ……((((..(((((((..(((…((((…(((……..)))….))))….))).)))))))..))))………((…..))..
RS 3 seq AAACUUGAAAGUAAGCAAACUUGUAUAAGUUAACAUAAUGGGUUAACGUUUCUACAAGACACCUAUGUCUUUUCUAUAAGUUAUAAUUAAAGUUCC
RS 3 dot .((((((((((((((….((((((.((((((((…….)))))).))..))))))….)).)).)))))….)))))…………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table