Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022634 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA022634
Gene: CLGN
MFE: -53.146
ENS: 0.926
Length: 159.
Predicted Ligands:
FMN - 15/20
Mg2+ - 2/20
molybdenum - 2/20
 RS: URS0000D7BD2F_1572656
MFE: -41.717
Ligand: Mg2+
Species: Ruminococcaceae bacterium CPB6 M-box riboswitch (ykoK leader)
 RS: URS0000D7D36D_1324314
MFE: -42.793
Ligand: FMN
Species: Paenibacillus selenitireducens FMN riboswitch (RFN element)
 RS: URS0000ABA951_1525218
MFE: -62.335
Ligand: FMN
Species: Sulfitobacter sp. CB2047 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022634 URS0000D7BD2F_1572656 URS0000D7D36D_1324314 URS0000ABA951_1525218
Length 159. 160. 158. 159.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.926 - - -
MFE -53.146 -41.717 -42.793 -62.335
Ligands - Mg2+ FMN FMN
Gene CLGN - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 19.006 13.002
Length SE - 1. 1. 0.
Lev Distance - 57. 54. 59.
UBS 14. 12. 13. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 2.
ILR 3. 4. 3. 1.
H 6. 5. 4. 6.
BL 5. 3. 4. 4.
BR 1. 2. 4. 3.
UN 0.069 0.037 0.146 0.113

Sequences

Field Description
UTR seq + 25 cgcacgcgcgguuaguagucgcugcugcgcggccgccggcgggacuggucugaagagacgcggggaccaaguggcaacgacuuggacaucugagcugucacugccgaaaacaggccgcaagagagauaaucaauATGCATTTCCAAGCCTTTTGGCTAT
UTR dot + 25 (((.((.((((((.(((((….)))))..)))))))))))((.(((((((….)))).)))…)).(((((((..(.(((((….)))))))))))))(((…….))).(((…((…..))….)))…….((((….))))..
RS 1 seq UUCGAUAUCUGGUAGGUGAGGCUCCUACAGGGAUACGGACUGCUGCCGCGGAGUGGUGGAGACACUAUGAGAAGGUUUGAACAGGUUAUAUCGACAACAAGGUAUAACAUAAUGCAGUUUCAUCGCCCUGUAAAGCUAAAGCUCAAACAUCGGUGCGGAA
RS 1 dot ((((.(((((.(((((…….)))))..)))))))))((((….)))).((((((….))))))..((((.(……..((((((((……..))))))))…….).)))).(((((((((..(((….)))…)))..)).))))..
RS 2 seq UUGUUCCUUCGGGGUCGGGUGAAAUUCCCAACCGACGGUGAUACGAAUGUGAUCAUUCGUUAAGUCCGUGACCCGGAUCACGCUCAAUUGUGACGUGAGAAGGUGGACUCGGUGUAAAUCCGAGACCGACAGUAAAGUCUGGAUGGGAGAAGGGAACG
RS 2 dot .((((((.((((….(((…….)))..)))).)).))))((((((….))))))…(((((…(((….(((((.(((….))))))))…))))))))………(((.(..(.(((……))).)..).)))……….
RS 3 seq CCCUAUUCUCAGGGCGGGGCGCAAUUCCCCACCGGCGGUAUGUGGCCCCAGUGCCACGAGCCCGCGAGCGCUGGCGACAUCCCUUCGGGAUGCGCCGGGUCAGCAGAUCUGGUGAGAUGCCAGAGCCGACGGUCAUAGUCCGGAUGAAAGAGAAUGCGU
RS 3 dot ((((……)))).((((…….))))..((..(((.((((((……)))))).)))..))….((((((.((((((…))))))))))))(((.((…((((((…..)))))))).)))……….((.((……..)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table