Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022708 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA022708
Gene: CLIP4
MFE: -42.130
ENS: 0.823
Length: 97.
Predicted Ligands:
TPP - 15/20
SAM - 3/20
glycine - 1/20
 RS: URS0000C60226_631454
MFE: -44.416
Ligand: glycine
Species: Phyllobacteriaceae bacterium AMV1 Glycine riboswitch
 RS: URS0000D8F54C_1302250
MFE: -21.753
Ligand: SAM
Species: Lactobacillus silagei JCM 19001 SMK box translational riboswitch (SAM-III)
 RS: URS0000D8AB9C_1435342
MFE: -21.753
Ligand: SAM
Species: Lactobacillus mixtipabuli SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022708 URS0000C60226_631454 URS0000D8F54C_1302250 URS0000D8AB9C_1435342
Length 97. 98. 97. 97.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.823 - - -
MFE -42.130 -44.416 -21.753 -21.753
Ligands - glycine SAM SAM
Gene CLIP4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6. 6.
Length SE - 1. 0. 0.
Lev Distance - 24. 25. 25.
UBS 5. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 2. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 1. 1. 1.
BR 0. 1. 2. 2.
UN 0.103 0.112 0.124 0.124

Sequences

Field Description
UTR seq + 25 gugaaggcggugggcacgcacggcgugccggggccgccuggcuucgcggcgggggagguggcuuucuagaagATGACCATAGAGGACCTTCCAGATT
UTR dot + 25 (((((((((((.(((((((…)))))))…)))))))….))))…..(((((((…((((((………..)))))))))))))…..
RS 1 seq CUCUGGAAAGCAGCCGGCGGCAUCGCGUCGCCGGCUCACCGACGGGGGUAAGCUCGCGGGAUCUGCCGCGGCGAAAUCUCUCAGGUCCUGCGACAGAG
RS 1 dot (((((……((((((((((…..))))))))))……)))))……((((((((((((….((.(….).))))))))))))))…..
RS 2 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUUGACUUAGUGAAGAUGCCUUGUAACCGAAAAAAGAUAUUGGGGGAAUUUUUACAAUG
RS 2 dot ..(((((((((((((((……))..))))))).))))))……((((((((.(((…..((((………))))))).))))))))….
RS 3 seq AAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUUGACUUAGUGAAGAUGCCUUGUAACCGAAAAAUGAUAUUGGGGGAAUUUUUACAAUG
RS 3 dot ..(((((((((((((((……))..))))))).))))))……((((((((.(((…..((((………))))))).))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table