Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022801 Similarity: 0.964 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA022801
Gene: CLK2
MFE: -28.141
ENS: 0.819
Length: 141.
Predicted Ligands:
cobalamin - 10/20
TPP - 5/20
FMN - 4/20
 RS: URS0002327E51_1797404
MFE: -42.921
Ligand: cobalamin
Species: Bdellovibrionales bacterium RIFOXYD1_FULL_55_31 Cobalamin riboswitch
 RS: URS0000C4B02C_383855
MFE: -46.119
Ligand: TPP
Species: Pseudocercospora fijiensis CIRAD86 TPP riboswitch (THI element)
 RS: URS0000C6CD7B_321146
MFE: -40.160
Ligand: TPP
Species: Mycosphaerella eumusae TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022801 URS0002327E51_1797404 URS0000C4B02C_383855 URS0000C6CD7B_321146
Length 141. 141. 140. 140.
Similarity - 0.964 0.958 0.957
Ensemble Norm 0.819 - - -
MFE -28.141 -42.921 -46.119 -40.160
Ligands - cobalamin TPP TPP
Gene CLK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 5.007 2.008
Length SE - 0. 1. 1.
Lev Distance - 47. 52. 55.
UBS 14. 14. 14. 14.
BS 0. 0. 0. 0.
ILL 4. 5. 4. 4.
ILR 4. 4. 5. 4.
H 3. 3. 3. 3.
BL 6. 5. 4. 5.
BR 5. 4. 5. 4.
UN 0.156 0.071 0.071 0.064

Sequences

Field Description
UTR seq + 25 gagaccuacgaagcgacggaguagggagaugagggggaaggaggucggccugcguuagauguaccaagaagaccuguaggaagcuugggcggaaccagacuagaagggaugauagaATGCCGCATCCTCGAAGGTACCACT
UTR dot + 25 ….(((((………..)))))…………..(.(((((..(.((.((…….)))).)..))))).).((.(.(((.(((((…((..(((..(….)..)))..))))))…..).))).).))…
RS 1 seq GUUGACAUUCGUGCCGCGAGACCAUAGCAUCGCGCCACGAAUCACGGAGAGCUGAAGCCCGGUGAAAUUCCGGCACUGUCCCGCAACGGUAAUUGAGCGACUUCGCUCAUCAGUCCGAACGCCCCGCGAGAUUCGAUGCGC
RS 1 dot ……(((((((.(((((..(….)..))))).)))))))…(((.((.((….((((…….)))))))).)))((((.(((..(((..(((.(((((..(….)..)))).)…)))..)))))).)))).
RS 2 seq GUGCAGCACUGCGGGCGCCGAGUGCAAAGCUCUGCAACUUCUGCAAAGCAGAGGCUUGACAGACUGUUGCACGAAGCUGAGAAGGACCGCUAUGACUCGAUCAAGAUAAUGCUUGCGUGAGAAAGUGCUGCCGCUUCUGC
RS 2 dot …..(((((.(((…))))))))..(((((((((((.((((..((((….))))..))))..)))))).)).))).((((((.(.((..(..((((..((((……))))..))))..)..)).).).)))))..
RS 3 seq GUGCAGCACUGCGGGCGCUAAGGGAAACAUUCUGCAAGUUCUGUGCAGCAGAUACUUGACAGAUUGUUGCACGAAGCUGAGAAGGACCGCUAUGACUCGAUCAAGAUAAUGCUUGCGUGAGAAAGUGCUGCCGCUUCUGA
RS 3 dot ((((.((…))..))))…….((((.((((((((((((((…))))).))))).)))).)))).((.(((((……((.(.((..(..((((..((((……))))..))))..)..)).)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table