Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022803 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA022803
Gene: CLK2_0
MFE: -27.386
ENS: 0.865
Length: 116.
Predicted Ligands:
TPP - 8/20
methionine - 6/20
FMN - 3/20
 RS: URS0000D9A7D3_2020377
MFE: -47.373
Ligand: methionine
Species: Sinomonas sp. R1AF57 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C4FD7F_37927
MFE: -49.866
Ligand: methionine
Species: Sinomonas atrocyanea S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000AB1888_584708
MFE: -46.327
Ligand: molybdenum
Species: Aminomonas paucivorans DSM 12260 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022803 URS0000D9A7D3_2020377 URS0000C4FD7F_37927 URS0000AB1888_584708
Length 116. 116. 117. 117.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.865 - - -
MFE -27.386 -47.373 -49.866 -46.327
Ligands - methionine methionine molybdenum
Gene CLK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 2. 1.004
Length SE - 0. 1. 1.
Lev Distance - 28. 31. 32.
UBS 10. 9. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 2. 2. 3.
H 2. 2. 2. 2.
BL 5. 3. 5. 5.
BR 4. 4. 4. 4.
UN 0.172 0.181 0.154 0.111

Sequences

Field Description
UTR seq + 25 ucacccgcuccugcucgauuuccacugcuuuguggcugccgaacacccgaagggagaacuuguugaccguaggcuggagcagcgucccaagATGCCGCATCCTCGAAGGTACCACT
UTR dot + 25 ………((((((((((…..((.((((.(((.((…..)).))))))).))…..)))))..)))))(.(((((.(((((….))))).)).)))..)………..
RS 1 seq AAUCAAGAGAUCCGGUGGCAAGCCCUGGCUGGCCGGACGGCAACCCUCCUGCUGUAGCGGGGUGCUCCAGGUGAGGAUUCGACGGCGCCGGCAGACCGGCGUCGUAAGUAUGGCGC
RS 1 dot ……..(((((..(((..((((((.((((((.(((.((…)).))).)))..))).))).))))))…..)))))..((((((((((….))))))))))………..
RS 2 seq AAUCAAGAGUUCCGGCAUCAAGCCCUGGCUUGCCGGACGGCAACCCUCCGGCUGUAGUGGGGUGCCCCAGGUGAGGAUUCGACGGCGCGCGGGCCCCCGGCGCCGUAAGUAUGGCGC
RS 2 dot ……(((.(((..((((..(((((.(((.((((((.((…)).))))))…))).))).))….)))).)))))).(((((((.(((….))))))))))………..
RS 3 seq CUUGGUUUCAACCUCCGAGCCCCUCUUCCUAAGGGCAUCGCCUAAGGAAUCGGGCCAUCGGGCGUGCCUGGAAACGGGACCGCCUCCCGCUUGGAAAGGGGGUUCCGGUGUGCCGUU
RS 3 dot ((.(((….((.(((((((((…(((((.(((……))).)))))..))))..))))).))))).))…(((((((.(((.((….))..))).)))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table