Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022920 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA022920
Gene: CLNK
MFE: -11.918
ENS: 0.915
Length: 111.
Predicted Ligands:
SAM - 11/20
molybdenum - 6/20
glycine - 2/20
 RS: URS0000C55DF0_360411
MFE: -36.949
Ligand: molybdenum
Species: Bellilinea caldifistulae Moco (molybdenum cofactor) riboswitch
 RS: URS0000D7B97D_1797839
MFE: -37.997
Ligand: molybdenum
Species: Deltaproteobacteria bacterium RBG_16_48_10 Moco (molybdenum cofactor) riboswitch
 RS: URS0000ABB45F_574087
MFE: -29.847
Ligand: molybdenum
Species: Acetohalobium arabaticum DSM 5501 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022920 URS0000C55DF0_360411 URS0000D7B97D_1797839 URS0000ABB45F_574087
Length 111. 111. 111. 110.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.915 - - -
MFE -11.918 -36.949 -37.997 -29.847
Ligands - molybdenum molybdenum molybdenum
Gene CLNK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 4. 2.001
Length SE - 0. 0. 1.
Lev Distance - 25. 27. 27.
UBS 7. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 0. 1. 2.
ILR 1. 0. 0. 2.
H 3. 3. 3. 3.
BL 2. 3. 3. 2.
BR 2. 3. 1. 1.
UN 0.252 0.279 0.252 0.227

Sequences

Field Description
UTR seq + 25 gucauuauauguuagaagugcaaucaguacauaacuggaauuuuuaaaucaaucuguaacugauuuuaaaagaucauagaggaggcATGAACAGGCAGGGCAATAGAAAGA
UTR dot + 25 ………..((((((((….(((((…..))))).))))))))…..(((.((..((((((….)))))))).)))..((.((……))..))……….
RS 1 seq UCCAAUGAUUUCCUCCGAUCCAUCAAUUCCCUCCGGGAUAGAUGGACGAUAGGGCAUGAGAGGCAACUUUCAUCGCCUGCCGUUUUGCAAAGGAGGGCCACCCGUUCAAAC
RS 1 dot ……………((.((((((.(((((….))))).))))))))…(((((((((((….))))))).))))(((.((((….)))).)))………….
RS 2 seq UAAAUAUAGAUCCUCCGAUCCAUUUCUUCCCCUCGGGAAGAAUGGGCGUUAGGGUGCGGGGAGCAAUCCCUUCACCUGCCGCAUUUGCAAAGGAGGCAACGGAAAAACUGC
RS 2 dot ……………((.((((.((((((((…))))))))))))))…(((((.(((((….))))).))))).(((…((((…….)))))))………
RS 3 seq CUAGUCAAUUACCUCCGAUCUUACUUAUCCCUCUGGGAUUUGUAAGACGUUAGGGUAUAGAGAGUAAUCGCUAUGCCUGCCAUUAGCAAAGGAGCUUAUUCUGGAUUCAA
RS 3 dot ……………((.((((((..(((((…)))))..))))))))…((((((((.((….)).)))))))).(((..(((……)))…..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table