Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA022946 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA022946
Gene: CLPB
MFE: -29.451
ENS: 0.868
Length: 75.
Predicted Ligands:
homocysteine - 7/20
SAM - 7/20
fluoride - 6/20
 RS: URS0000D7A703_2008440
MFE: -29.029
Ligand: fluoride
Species: Thermococcus sp. 5-4 Fluoride riboswitch
 RS: URS0000D9CE93_2264
MFE: -29.545
Ligand: fluoride
Species: Thermococcus celer Fluoride riboswitch
 RS: URS0000D8FD77_71998
MFE: -28.629
Ligand: fluoride
Species: Thermococcus pacificus Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA022946 URS0000D7A703_2008440 URS0000D9CE93_2264 URS0000D8FD77_71998
Length 75. 75. 74. 74.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.868 - - -
MFE -29.451 -29.029 -29.545 -28.629
Ligands - fluoride fluoride fluoride
Gene CLPB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0. 0. 0.001
Length SE - 0. 1. 1.
Lev Distance - 16. 16. 16.
UBS 6. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 3. 3. 3. 3.
H 1. 1. 1. 1.
BL 2. 2. 2. 2.
BR 2. 2. 2. 2.
UN 0.093 0.093 0.095 0.122

Sequences

Field Description
UTR seq + 25 guggucagcacaggggccggcaccacgggguuaucgaagcagcugucaagATGCTGGGGTCCCTGGTGTTGAGGA
UTR dot + 25 ….(((((((((((((((((((.((((.(((…..)))..))))…).))))..)))))))).))))))…
RS 1 seq GGUCUUUCGGGCGAUGGCGUCCGCCCGGGCUUCGAGCCGAACCGCCCGUCGAGGGCUGAUGACGCCUGUUCUCCG
RS 1 dot …….((((.(((((((((.((((((((((((…))))..))))…..))))….)))))).))).))))
RS 2 seq GUUCCACCGGGCGAUGGCGUCCGCCCGGGCUUCGAGCCGAACCGCCCUCCAGGGCUGAUGACGCCUGUUCUCCG
RS 2 dot …….((((.(((((((((.((((((((((((…))))..))))….))))….)))))).))).))))
RS 3 seq GGUUCCAUGGGCGAUGGCGUCCGCCCGGGCUUCGAGCCGAACCGCCCUCAUGGGCUGAUGACGCCUGUUCUCCG
RS 3 dot ……..(((.(((((((((.((((((((((((…))))..))))….))))….)))))).))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table