Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023120 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA023120
Gene: CLYBL
MFE: -14.431
ENS: 0.839
Length: 105.
Predicted Ligands:
TPP - 17/20
guanidine - 2/20
glycine - 1/20
 RS: URS0000C7D983_1262783
MFE: -26.318
Ligand: TPP
Species: Clostridium sp. CAG:242 TPP riboswitch (THI element)
 RS: URS0000D785F6_1121306
MFE: -20.901
Ligand: TPP
Species: Clostridium collagenovorans DSM 3089 TPP riboswitch (THI element)
 RS: URS0000DA0D39_1908540
MFE: -25.099
Ligand: TPP
Species: Treponema sp. CETP13 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023120 URS0000C7D983_1262783 URS0000D785F6_1121306 URS0000DA0D39_1908540
Length 105. 105. 106. 106.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.839 - - -
MFE -14.431 -26.318 -20.901 -25.099
Ligands - TPP TPP TPP
Gene CLYBL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7.002 3.
Length SE - 0. 1. 1.
Lev Distance - 30. 29. 32.
UBS 5. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 3.
ILR 2. 2. 1. 2.
H 1. 2. 2. 2.
BL 0. 0. 1. 0.
BR 1. 1. 1. 0.
UN 0.162 0.181 0.208 0.170

Sequences

Field Description
UTR seq + 25 cuaaucaccuaugacacuucugauuuuaguuugcagacaaauuuucauuccacuuaaaaggccgaaaacuugaacaaccaATGGCGCTACGTCTGCTGCGGAGGG
UTR dot + 25 …………….(((((…….((..((((((……(((((……..(((……..)))……..)))))……)))))).))))))).
RS 1 seq AGCAUAAAAAAAGGGAGCUCGCAAACGGGCUGAGAGGAAGCUGUGCGCUUCGACCUGUGACCUGAUUUGGGUAAUGCCAACGUAGGGAGAUUAGCAUUGGUUUUC
RS 1 dot ……………((((((….))))))….(((((((((((…((..((((((…….((((……))))))))))..))…))).))))))))
RS 2 seq AAUAAAUGCUAGGGGUACCUUAAAUAAGAGGUUGAGAGGAUAAAUUAUCUAACCCUAUGAACCUGAUUUGGUUAAUACCAACGUAGGGAAGCACUUAAUAUAUCUA
RS 2 dot …………….(((((……)))))…..(((((.((((…..(((((((……..(((((….))))))))))))…….)))).))))).
RS 3 seq UAAAAAAUACAGGGGAGCUUGUGAACAAGCUGAGAGUAAGUUAGUAACUUAGACCCUUUUACCUGAUUUGGAUAAUGCCAACGUAGGAAGUCAUUUAACUUGCUUA
RS 3 dot ……………((((((….))))))..(((((((((((..((((………..((((..((((……))))..))))))))…))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table