Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023129 Similarity: 0.968 Similarity: 0.968 Similarity: 0.965
UTR: 5HSAA023129
Gene: CMBL
MFE: -29.081
ENS: 0.740
Length: 133.
Predicted Ligands:
FMN - 9/20
cobalamin - 5/20
TPP - 3/20
 RS: URS0000DA8526_1608910
MFE: -32.
Ligand: SAM
Species: Bacillus sp. HMSC76G11 SAM riboswitch (S box leader)
 RS: URS0000DB23CC_1529318
MFE: -45.426
Ligand: FMN
Species: Cryobacterium sp. MLB-32 FMN riboswitch (RFN element)
 RS: URS0000DB022E_71253
MFE: -44.981
Ligand: FMN
Species: Arthrobacter rhombi FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023129 URS0000DA8526_1608910 URS0000DB23CC_1529318 URS0000DB022E_71253
Length 133. 134. 132. 133.
Similarity - 0.968 0.968 0.965
Ensemble Norm 0.740 - - -
MFE -29.081 -32. -45.426 -44.981
Ligands - SAM FMN FMN
Gene CMBL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.010 2.005 5.005
Length SE - 1. 1. 0.
Lev Distance - 38. 41. 45.
UBS 6. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 4. 4. 3. 3.
ILR 3. 4. 3. 4.
H 1. 1. 1. 1.
BL 0. 2. 0. 1.
BR 0. 1. 1. 1.
UN 0.098 0. 0.030 0.030

Sequences

Field Description
UTR seq + 25 acacaagcccacacaagcccgggccccgcuccucugaacucccgcguguguucugacuauggcaaagaaggucuuugccgcgugcacggcccgacuuaaaucucugcaATGGCTAACGAAGCTTATCCTTGTC
UTR dot + 25 ….((((…….((((((((((..((…………..((((………….((((((((…))))))))))))))..))))))……………..))))……))))………
RS 1 seq CUCUUAUCCCGAGCUGGUGGAGGGACAGGCCCAAUGAAACCCAGCAACCUGCUUUAUUUUUAAAAUUCAUUCAUGAAUUUUUGCGAGCAAAGGUGCUAACCUGAUGCAAGGCGAAAGCCCUUGAUCGAUAAGAG
RS 1 dot ((((((((…….(((.(((((….(((………..(((.((((((((…….((((((((….))))))))…)))))..))))))…………)))…..))))).)))))))))))
RS 2 seq AACGUGCUCCGGGGUCGGUGUAAGUCCGAACCGGCGGUGAAAGUCCGCGACCCGUUCGUUCUUCACGAAUGAACGGUUGAGCUGGUGAAAUUCCAGCACCGACGGUUAAAGUCCGGAUGAGAGGCGCACGAA
RS 2 dot ..(((((((((((((((((((……..((((((..(((………..((((((((((…..))))))))))))).))))))………))))))))……..))))))……..)))))..
RS 3 seq ACACGUGCUCCGGGGUCGGUGUAAGUCCGAACCGGCGGUUAUAGUCCGCGACCCGAGGUGCCUCACGGCGCCGAGGUUGAACUGGUGGAAUUCCAGUACCGACAGUUAAAGUCUGGAUGGGAGAAGCACGUAC
RS 3 dot ..(((((((((((((((((((……….(((.(((((……..(((((…((((((….))))))..)))))))))).)))……..)))))))……..))))))……..))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table