Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023262 Similarity: 0.988 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA023262
Gene: CNKSR2
MFE: -13.626
ENS: 0.921
Length: 61.
Predicted Ligands:
cobalamin - 14/20
fluoride - 5/20
unknown - 1/20
 RS: URS0000C4130C_927083
MFE: -23.370
Ligand: cobalamin
Species: Sandaracinus amylolyticus Cobalamin riboswitch
 RS: URS0002332F0A_1797661
MFE: -25.769
Ligand: cobalamin
Species: Chloroflexi bacterium RBG_16_69_14 Cobalamin riboswitch
 RS: URS0000D9C85A_1993
MFE: -24.580
Ligand: cobalamin
Species: Actinomadura madurae Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023262 URS0000C4130C_927083 URS0002332F0A_1797661 URS0000D9C85A_1993
Length 61. 61. 61. 61.
Similarity - 0.988 0.986 0.986
Ensemble Norm 0.921 - - -
MFE -13.626 -23.370 -25.769 -24.580
Ligands - cobalamin cobalamin cobalamin
Gene CNKSR2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.017 4.002
Length SE - 0. 0. 0.
Lev Distance - 15. 18. 18.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 0.
ILR 0. 0. 1. 0.
H 3. 3. 2. 3.
BL 1. 0. 1. 2.
BR 1. 2. 1. 2.
UN 0.082 0.066 0.213 0.033

Sequences

Field Description
UTR seq + 25 gagcucugcgcucugcacggaaccgaccccguacccATGGCTCTGATAATGGAACCGGTGA
UTR dot + 25 ((((…..))))….(((……..)))((((…((.(((……))).)))))).
RS 1 seq ACCGGUGCGAAUCCGGUACGGCCCCCGCCACUGUGAUGAGGCAAUCCCGCCUCGAGUCAGG
RS 1 dot (((((…….)))))..(((….))).((((..((((((……)))))).).))).
RS 2 seq GCCGGUGAGAUCCCGGCACAGUCCCGCUACGGUGAGCGCUCUCCAGAGGGCGCGAGUCCGG
RS 2 dot (((((.(….))))))…………((((..(((((((….)))))))..).))).
RS 3 seq UCCGGUGAGAUGCCGGUGCGGACGCGCCACUGUAUCCGGGACGCGGAUCCCGGGAGCCAGG
RS 3 dot .(((((…..))))).(((….)))(.((((.(((((((……))))))).)).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table