Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023482 Similarity: 0.972 Similarity: 0.970 Similarity: 0.967
UTR: 5HSAA023482
Gene: CNPY4
MFE: -36.644
ENS: 0.876
Length: 128.
Predicted Ligands:
cobalamin - 9/20
TPP - 6/20
molybdenum - 2/20
 RS: URS0002313692_1788
MFE: -63.104
Ligand: cobalamin
Species: Mycobacterium terrae Cobalamin riboswitch
 RS: URS0000AB4325_12908
MFE: -23.671
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C1F151_1792508
MFE: -49.620
Ligand: TPP
Species: Yangia sp. CCB-MM3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023482 URS0002313692_1788 URS0000AB4325_12908 URS0000C1F151_1792508
Length 128. 129. 129. 127.
Similarity - 0.972 0.970 0.967
Ensemble Norm 0.876 - - -
MFE -36.644 -63.104 -23.671 -49.620
Ligands - cobalamin cobalamin TPP
Gene CNPY4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 6.004 3.001
Length SE - 1. 1. 1.
Lev Distance - 35. 36. 42.
UBS 10. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 2.
ILR 3. 2. 2. 2.
H 2. 3. 2. 3.
BL 5. 5. 4. 5.
BR 3. 3. 3. 3.
UN 0.102 0.039 0.163 0.071

Sequences

Field Description
UTR seq + 25 gcuggauuuaagguugccgcuagccgccugggaauuuaagggacccacacuaccuucccgaaguugaaggcaagcggugauuguuuguagacggcgcuuugucATGGGACCTGTGCGGTTGGGAATAT
UTR dot + 25 …………(((((((((.(((((.(((((…..(((………..))))))))..))….))).)))))))))(((((.((.((.((((…(((….)))..)))).)))).))))).
RS 1 seq CUGCGCUAGGCUGGCCGCCGUCUCGUGGCGUCAGGAACCCGGUGGAAUUCCGGGGCGGUUCCGCCACUGUGAGCGGCGCGGUUCGUCGUGCGCCGACAGCCAGAUACUGGCCGCGGGGCACCCGACCGG
RS 1 dot ….((((…))))(((((.(((((((((…….(((((…….)))))…….))))))…))))))))((((.((..((((.(((.(.(((((…))))).)))).)))).)))))).
RS 2 seq GUGUUGAAACUUGGUGGGGAAUCAGUGCGUAAUUCAUUGGCUCUACCUGGAACCGUAAAGUCGGAGUACCACCCAACAUAGCCCGCUGUUGAAUGAAGGCCAGGAAAAGUCUAGUUCUACUAUUAAAAA
RS 2 dot …………((((((..((..(((.((.((((..(((((.(((……..))).))))))))))))))…..))..))))))((.((((..((((……..)))).)))).))………
RS 3 seq GGCCAACGUCAGGGGAGUCCCGCCAUGGGGACUGAGAGGCUGACAGGGACGCUGCGGCGUCCCGGUGACGCGACCCUUUGAACCUGACCCAGUUGACGCUGGCGUAGGAAGACCGAAGGGCAAUCUU
RS 3 dot ……..(((((((.(((.((.(((.(((((……((((.(((…..)))))))))))).))).)).)))))))))).((((..(((((….)))))..))))((((((….))…))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table