Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023512 Similarity: 0.965 Similarity: 0.964 Similarity: 0.963
UTR: 5HSAA023512
Gene: CNTN1
MFE: -25.653
ENS: 0.879
Length: 138.
Predicted Ligands:
molybdenum - 7/20
FMN - 4/20
TPP - 4/20
 RS: URS0000D794BF_637679
MFE: -47.890
Ligand: molybdenum
Species: Kordiimonas sp. S3-22 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C529EE_1249634
MFE: -51.230
Ligand: molybdenum
Species: Serratia marcescens FGI94 Moco (molybdenum cofactor) riboswitch
 RS: URS000232AC04_1193682
MFE: -58.661
Ligand: cobalamin
Species: Actinokineospora bangkokensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023512 URS0000D794BF_637679 URS0000C529EE_1249634 URS000232AC04_1193682
Length 138. 137. 139. 139.
Similarity - 0.965 0.964 0.963
Ensemble Norm 0.879 - - -
MFE -25.653 -47.890 -51.230 -58.661
Ligands - molybdenum molybdenum cobalamin
Gene CNTN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3. 6.003
Length SE - 1. 1. 1.
Lev Distance - 44. 46. 46.
UBS 11. 12. 10. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 2. 3. 3. 4.
H 4. 4. 4. 4.
BL 3. 4. 3. 3.
BR 2. 2. 1. 3.
UN 0.087 0.058 0.086 0.029

Sequences

Field Description
UTR seq + 25 gcugugccgcaccgaggcgagcaggagcagggaacagguguuuaaaauuauccaacugccauagagcuaaauucuuuuuuggaaaauugaaccgaacuucuacugaauacaagATGAAAATGTGGTTGCTGGTCAGTC
UTR dot + 25 (((.((((…….)))))))..(.(((((((…(((…….))).)))..)))))……(((((……)))))…((((.((((..(..((((………………))))..).)))))))).
RS 1 seq AAGAGUGCCCAACUCCGAAGCCUCUGGCUCUAAGUGACCCAUGUCAUACGAGCCUUUGGCCGCAGCCAAUGCUGCCGGGUCUGCGCGGGAAACCGUCUGGCCUCUCGCGAUUAGAAAGGAGCCAGCUUGUGCGCUUA
RS 1 dot .((((.((………..))))))(((((…(((((….)))))..)))))…(((((((((….)))))..)))).(((((.((….(.(((((.(((..(…..)..))).)))))))).)))))…
RS 2 seq CUGAGAUCACAACUCCUAGCCCCUGUGCCUACGUCGCUUGGCGAUAUGGCGCCCGGGCCGUGGCGAAGUCAGCCACCAGGGUGCGCGAUAGAAAUGUCCGCAUCUCCCGUAUUUGGAAAGGUGUUAUGGUGCCCCAACU
RS 2 dot ..(((…….)))…((((..(((((…(((((…)))))..)))))..)))).(((((…….)))))..(((.((((.(((………((((((.(((….)))..))))))))).)))))))….
RS 3 seq CGGGAACCAGCCAGGGCCUGUGCUAGCUUCACCGGGCCCACAGGGGAACCCGGUGCGAAGCCGGGACUGACGCGCAGCGGUGUGGACCGCCCCUCGGGGCGUUCCGAGUCCGAAUGCCUGCGGGCACACCACCCGGCAG
RS 3 dot ((((..((…..)).))))(.((.((((((((((((((….)))..))))))..))))).)).)(((…..)))(((.((((…((((….((((((((…….))))))))..))))…)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table