Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023531 Similarity: 0.978 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA023531
Gene: CNTN4
MFE: -16.370
ENS: 0.843
Length: 93.
Predicted Ligands:
TPP - 12/20
glycine - 3/20
Ni/Co - 2/20
RS: URS0000C80F71_1497954
MFE: -33.654
Ligand: TPP
Species: Bacteroidales bacterium KA00344 TPP riboswitch (THI element)
RS: URS0000AB8CCA_585502
MFE: -33.654
Ligand: TPP
Species: Prevotella bergensis DSM 17361 TPP riboswitch (THI element)
RS: URS0000ABCA9E_96561
MFE: -24.622
Ligand: TPP
Species: Desulfococcus oleovorans Hxd3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023531 URS0000C80F71_1497954 URS0000AB8CCA_585502 URS0000ABCA9E_96561
Length 93. 94. 94. 95.
Similarity - 0.978 0.978 0.978
Ensemble Norm 0.843 - - -
MFE -16.370 -33.654 -33.654 -24.622
Ligands - TPP TPP TPP
Gene CNTN4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 3.005 2.021
Length SE - 1. 1. 4.
Lev Distance - 28. 28. 25.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 2. 2. 2.
H 2. 3. 3. 2.
BL 2. 1. 1. 1.
BR 1. 0. 0. 1.
UN 0.312 0.245 0.245 0.168

Sequences

Field Description
UTR seq + 25 auaccagauggaggcuuugauuugcucaaccuaauuggauucaaaaaauaaaugauauucacguggccATGAGGTTGCCATGGGAACTGCTGG
UTR dot + 25 …((((..((.(((……..)))…))…))))……………….(((.((((((………)))))).)))…….
RS 1 seq UGCUGUCUAAGGGGUGCUAGCCCAGUUGGGCGGCUGAGAACAUACCCAUGAACCUGAUCCGGAUAAUGCCGGCGUAGGUAGGAUAACUCCCCCU
RS 1 dot .(((((((((.((((….))))..)))))))))……………..(((((..((((……))))..))))).(((….)))….
RS 2 seq UGCUGUCUAAGGGGUGCCAGCCCAGUUGGGCGGCUGAGAACAUACCCAUGAACCUGAUCCGGAUAAUGCCGGCGUAGGUAGGAUAACUCCCCCU
RS 2 dot .(((((((((.((((….))))..)))))))))……………..(((((..((((……))))..))))).(((….)))….
RS 3 seq AUGCAGGAUUGGGGGUGGCGACAGAAAGCCUGAGAACAUACCCUUUGAACCUGGUCUGGGUAAUGCCAGCGUAGGGAAAUUGCAGCGGUAUGGUU
RS 3 dot …((((…(((((((((……..)))………))))))….))))………(((((.((((((…..)))).)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table