Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023723 Similarity: 0.990 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA023723
Gene: COIL
MFE: -17.629
ENS: 0.779
Length: 56.
Predicted Ligands:
unknown - 10/20
glutamine - 10/20

 RS: URS0000E6083E_1420583
MFE: -25.042
Ligand: unknown
Species: Sphingobium czechense LL01 nhaA-I RNA
 RS: URS0000D6889F_12908
MFE: -21.142
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000C6A044_12908
MFE: -9.166
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023723 URS0000E6083E_1420583 URS0000D6889F_12908 URS0000C6A044_12908
Length 56. 56. 55. 56.
Similarity - 0.990 0.990 0.989
Ensemble Norm 0.779 - - -
MFE -17.629 -25.042 -21.142 -9.166
Ligands - unknown unknown glutamine
Gene COIL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 6. 1.003
Length SE - 0. 1. 0.
Lev Distance - 11. 11. 14.
UBS 5. 4. 5. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 0. 0. 2.
H 1. 1. 1. 1.
BL 1. 0. 2. 2.
BR 2. 3. 3. 2.
UN 0.089 0.089 0.091 0.143

Sequences

Field Description
UTR seq + 25 aucucucggcuuccguugagcaccaagcaagATGGCAGCTTCCGAGACGGTTAGGC
UTR dot + 25 (((((((((((.(((((..((…..))..))))).)))…))))).)))…..
RS 1 seq GGGUGUUCGCCAUGAUGCAGGCGGGCAGGUUUGUGUCGUUGGUCGGGCCGCCAGCG
RS 1 dot .(((((((((((((((((((((……))))))))))).)).))))).)))….
RS 2 seq GGGUGUCCGCACUGUUGUGCUUUGGCAGGUCAUAGCGCUGGUCGGGCCGCCAGCG
RS 2 dot .((((((((.(((…(((((.((……)).))))).)))))))).)))….
RS 3 seq AUCGUUCAUUUUGAGUAUCUCAAAACGGAAGUAAGCGAAAGUUGAAGGAACGCAUG
RS 3 dot .((.(((((((((..(((.((……)).)))..)))))..)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table