Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA023919 Similarity: 0.977 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA023919
Gene: COL5A3
MFE: -47.906
ENS: 0.875
Length: 111.
Predicted Ligands:
TPP - 16/20
methionine - 2/20
SAM - 1/20
 RS: URS00019BCD07_2038398
MFE: -55.298
Ligand: TPP
Species: Sphingomonas sp. EC-SD391 TPP
 RS: URS0000D8EBFE_1839780
MFE: -52.120
Ligand: methionine
Species: Streptomyces sp. MnatMP-M17 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000C6C37A_1660099
MFE: -39.035
Ligand: TPP
Species: Erythrobacter sp. SCN 62-14 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA023919 URS00019BCD07_2038398 URS0000D8EBFE_1839780 URS0000C6C37A_1660099
Length 111. 110. 110. 110.
Similarity - 0.977 0.975 0.974
Ensemble Norm 0.875 - - -
MFE -47.906 -55.298 -52.120 -39.035
Ligands - TPP methionine TPP
Gene COL5A3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 3. 5.002
Length SE - 1. 1. 1.
Lev Distance - 29. 31. 32.
UBS 9. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 5. 4. 4. 3.
ILR 2. 2. 3. 2.
H 2. 2. 2. 2.
BL 1. 2. 2. 1.
BR 3. 2. 3. 4.
UN 0.009 0.091 0. 0.055

Sequences

Field Description
UTR seq + 25 gcgagugacugcaccgagcccgagaagucgccgcgccccgcagccgccccgacugguuccccgccuugcccgugggccccgccgggATGGGGAACCGCCGGGACCTGGGCC
UTR dot + 25 (((.((((((….((….))…)))))))))((((…((….((((..((((((((((…..(((((((…)))).))).)))))))))).))))..)))))).
RS 1 seq CGCGCAUCCCCGGGGGGCCGCUGAUGCGCGGCUGAGAGGUGGGCUGCAGCCCAUGACCCGCUGAACCUGAUCCGGCUGAUACCGGCGUAGGGAGGGUCUGCGGCUGGCCC
RS 1 dot ((((((((..(((….)))..))))))))……….((((..(((((((.(((((.(….((((..((((……))))..))))).))))))).)))))))))
RS 2 seq GCUCAGGUGGGUCAUCGGCCCCGGCCCGCUGGCAGGCAACCCUUCCACUGCGACGGGGUGCCCCGGGUGACGACCAGGUCCCGCCCCGGGCGGUGGGGCAAGUGCGGUCU
RS 2 dot (((..((((((((………)))))))))))((((..(.((((((((((..(((((((..((.(((….))).))…))))))).))))))))…)).)..))))
RS 3 seq AGACUAUCCCCGGGGAGCCUGCUGAGGCUGAGAGGUGGGUGUAAGCACCCCACGACCCGUCGAACCUGAACCUGUUAACACAGGCGGAGGGAGUGGGCAGGUCGCUUGGA
RS 3 dot ….(((((((….(((((….)))))….)).)))))((((((((((((..(((.(((……..(((((….)))))))).))).)))))…)).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table