Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024007 Similarity: 0.956 Similarity: 0.950 Similarity: 0.949
UTR: 5HSAA024007
Gene: COMMD10
MFE: -40.042
ENS: 0.766
Length: 171.
Predicted Ligands:
lysine - 9/20
glucosamine - 6/20
Mg2+ - 2/20
 RS: URS0000ABBF70_373903
MFE: -64.326
Ligand: glucosamine
Species: Halothermothrix orenii H 168 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C0520F_1221538
MFE: -44.330
Ligand: lysine
Species: Lactobacillus florum 8D Lysine riboswitch
 RS: URS0000C7BFB5_1262940
MFE: -46.561
Ligand: lysine
Species: Roseburia sp. CAG:100 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024007 URS0000ABBF70_373903 URS0000C0520F_1221538 URS0000C7BFB5_1262940
Length 171. 171. 170. 173.
Similarity - 0.956 0.950 0.949
Ensemble Norm 0.766 - - -
MFE -40.042 -64.326 -44.330 -46.561
Ligands - glucosamine lysine lysine
Gene COMMD10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 6. 5.004
Length SE - 0. 1. 4.
Lev Distance - 56. 63. 60.
UBS 11. 11. 12. 12.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 3. 1. 1.
H 5. 3. 7. 5.
BL 4. 5. 4. 3.
BR 4. 4. 4. 5.
UN 0.164 0.129 0.176 0.225

Sequences

Field Description
UTR seq + 25 aguuccgguucagacacucuggugggaaaggcucacgcugcugcuggagggucuuuaauagccaacauguguuaauaccccuuuuaaaucaguaucgaauaggggaccgaauuuuugguugguagaagaaucuagccuggcuuugcATGAAGAAAGCAGTGTCACTGATAA
UTR dot + 25 ……((((.((((.(((((((((.(..(…..)..).))))))))).))))…..))))…………..(((((………………)))))(((((….))))).((((((….)))).))((((.((((………)))).))))…….
RS 1 seq AUUUAAAGAAAAGCGCCUGGACUUAGAUGAAAAUAUUAUCUUCAUCUAAGUUGACGAGGGAGGGGGUUAUCGAAAUGAUCGGCGGAUGCCCCCAGGCCUUCUGCCGGGCCUGAAGUCAUUCCUCAAACCCGUGGAGUGAUCUACGGAACAAAGGGAAUGACAGGCAGAAAA
RS 1 dot …….((.((.(.(((.((((((((((((………)))))))))))).)…….)).).)).))……..(((((((.(((….)))..))))))).((((…(((((((((…..(((((((….)))))))……)))))))))))))……
RS 2 seq CUUAAAUAAAGAGGUGCGUUGUUCAUUAGUAAAUUGGGGGAGGCUGCUCAGUCGUAGAAACCAAUUAAAAGGGGCCAUCGCCGAAAUCAAGCUAUUAGCACUGGCUUGAUUGGGGUUUGAUUGAACAAGUCAAACACUGUCGCAUGUAAAUGCGGGGCGCUUUGUGGGAU
RS 2 dot ……….(((..((.((.((((………)))).)).))..)))………..((……..))(((….)))..((((((((((…….))))))))))…((((((((…..))))))))..(.((((((….)))))).)(.(…..).)..
RS 3 seq AAAAGAGAUAGAGGUUGCGUUUUUCAUUAGUACUUUCUAGGAGACGACAGGCGUCUGUGAACAGAGAGGAAAGGGGAAUACGCCGAAAGAGGAGGCUUCCUGGGAGCGUCUUGCUUGGGCAUGCAGUGAAGAACUGUAUGACUGUCAUCGACAGAUGGGGAGCUAUCAUUUAU
RS 3 dot …….(((((.((((((((((…((((……)))))))))).))).).)))))……………………((.((..((((.(((((…))))).))))..)).))((((((((…..))))))))..((((…))))(((((….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table