Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA024011 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA024011
Gene: COMMD2
MFE: -23.656
ENS: 0.931
Length: 72.
Predicted Ligands:
fluoride - 7/20
cobalamin - 6/20
homocysteine - 4/20
 RS: URS0000BE38F2_398527
MFE: -14.516
Ligand: fluoride
Species: Burkholderia phytofirmans PsJN Fluoride riboswitch
 RS: URS0002318D4E_113562
MFE: -28.876
Ligand: cobalamin
Species: Actinoplanes derwentensis Cobalamin riboswitch
 RS: URS0000D79995_1805088
MFE: -26.942
Ligand: homocysteine
Species: Comamonadaceae bacterium CG1_02_60_18 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA024011 URS0000BE38F2_398527 URS0002318D4E_113562 URS0000D79995_1805088
Length 72. 72. 71. 72.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.931 - - -
MFE -23.656 -14.516 -28.876 -26.942
Ligands - fluoride cobalamin homocysteine
Gene COMMD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.012 7.007 5.003
Length SE - 0. 1. 0.
Lev Distance - 21. 19. 21.
UBS 5. 4. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 1. 2. 2.
H 2. 1. 2. 1.
BL 1. 1. 0. 2.
BR 2. 1. 0. 1.
UN 0.167 0.278 0.085 0.222

Sequences

Field Description
UTR seq + 25 gcgaaggcggggucggcgcugccgggugaaaucguaggacagugaagATGCTGCTGGAATTGTCCGAGGAGC
UTR dot + 25 …..(((((.(((..(((((((………….)).)))))..))).)))))(((….)))…….
RS 1 seq GAAGCUUUCGGAGAUGGCAUUCCUCCCGUAACCGCCCUGCAUUCCCGCAGAGCUGAUGAUGCCUACGAGUUC
RS 1 dot ..(((((((((.((..(((………………)))..))))).))))))………………
RS 2 seq GAGGAAGCCGGUGUGAGUCCGGCGCGGUCCCGCCACUGUCACCAGGGUUUUCUCCUGGCAGCCAGGAACUC
RS 2 dot (((((((((((((..(((..((((……)))))))..))))..)))))))))((((…))))……
RS 3 seq CCAUCCAAGGAGCGUUGCAGUCGGCCACAUGGCCGGUCAGGCUUGGGUACCGUACAACGACGCUCACCUGCU
RS 3 dot ………((((((((..(((((((.((.((((…..))))))))..))).))..))))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table